seqprep →
1.3.2-4 →
armhf → 2019-12-19 05:19:11
sbuild (Debian sbuild) 0.71.0 (24 Aug 2016) on bm-wb-02
+==============================================================================+
| seqprep 1.3.2-4 (armhf) Thu, 19 Dec 2019 05:06:41 +0000 |
+==============================================================================+
Package: seqprep
Version: 1.3.2-4
Source Version: 1.3.2-4
Distribution: bullseye-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/bullseye-staging-armhf-sbuild-8d6ac0b9-2684-4556-afca-f6fbc3df93cf' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private bullseye-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private bullseye-staging/main Sources [11.5 MB]
Get:3 http://172.17.0.1/private bullseye-staging/main armhf Packages [12.8 MB]
Fetched 24.3 MB in 28s (875 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at:
https://salsa.debian.org/med-team/seqprep.git
Please use:
git clone https://salsa.debian.org/med-team/seqprep.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private bullseye-staging/main seqprep 1.3.2-4 (dsc) [2107 B]
Get:2 http://172.17.0.1/private bullseye-staging/main seqprep 1.3.2-4 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private bullseye-staging/main seqprep 1.3.2-4 (diff) [10.8 kB]
Fetched 37.2 MB in 4s (10.3 MB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/seqprep-yN1xEW/seqprep-1.3.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/seqprep-yN1xEW' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install build-essential |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-9SD5rS/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-9SD5rS/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-9SD5rS/gpg/trustdb.gpg: trustdb created
gpg: key 35506D9A48F77B2E: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg: imported: 1
gpg: key 35506D9A48F77B2E: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 35506D9A48F77B2E: secret key imported
gpg: Total number processed: 1
gpg: unchanged: 1
gpg: secret keys read: 1
gpg: secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Packages [433 B]
Fetched 2109 B in 1s (2669 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install core build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
libpam-cap netbase
Use 'apt autoremove' to remove them.
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 23 not upgraded.
Need to get 848 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [848 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 848 B in 0s (0 B/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 13002 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (armhf included in any all)
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev
Filtered Build-Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<<BUILDDIR>>/resolver-9SD5rS/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy sbuild-build-depends-seqprep-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Sources [516 B]
Get:5 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ Packages [594 B]
Fetched 2443 B in 1s (3124 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install seqprep build dependencies (apt-based resolver)
-------------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
libpam-cap netbase
Use 'apt autoremove' to remove them.
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils debhelper
dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base
groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libdebhelper-perl libelf1 libexpat1 libfile-stripnondeterminism-perl
libglib2.0-0 libicu63 libmagic-mgc libmagic1 libmpdec2 libpipeline1
libpython3-stdlib libpython3.7-minimal libpython3.7-stdlib libsigsegv2
libssl1.1 libsub-override-perl libtinfo5 libtool libuchardet0 libxml2 m4
man-db markdown mime-support po-debconf python3 python3-minimal python3.7
python3.7-minimal sensible-utils zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
vacation dh-make gettext-doc libasprintf-dev libgettextpo-dev groff
libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less
www-browser libmail-box-perl python3-doc python3-tk python3-venv
python3.7-venv python3.7-doc binfmt-support
Recommended packages:
curl | wget | lynx libarchive-cpio-perl libglib2.0-data shared-mime-info
xdg-user-dirs libltdl-dev libmail-sendmail-perl
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils debhelper
dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base
groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libdebhelper-perl libelf1 libexpat1 libfile-stripnondeterminism-perl
libglib2.0-0 libicu63 libmagic-mgc libmagic1 libmpdec2 libpipeline1
libpython3-stdlib libpython3.7-minimal libpython3.7-stdlib libsigsegv2
libssl1.1 libsub-override-perl libtinfo5 libtool libuchardet0 libxml2 m4
man-db markdown mime-support po-debconf python3 python3-minimal python3.7
python3.7-minimal sbuild-build-depends-seqprep-dummy sensible-utils
zlib1g-dev
0 upgraded, 49 newly installed, 0 to remove and 23 not upgraded.
Need to get 24.6 MB of archives.
After this operation, 93.3 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-9SD5rS/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [880 B]
Get:2 http://172.17.0.1/private bullseye-staging/main armhf libbsd0 armhf 0.10.0-1 [112 kB]
Get:3 http://172.17.0.1/private bullseye-staging/main armhf libtinfo5 armhf 6.1+20191019-1 [316 kB]
Get:4 http://172.17.0.1/private bullseye-staging/main armhf bsdmainutils armhf 11.1.2 [182 kB]
Get:5 http://172.17.0.1/private bullseye-staging/main armhf libuchardet0 armhf 0.0.6-3 [62.2 kB]
Get:6 http://172.17.0.1/private bullseye-staging/main armhf groff-base armhf 1.22.4-3 [782 kB]
Get:7 http://172.17.0.1/private bullseye-staging/main armhf libpipeline1 armhf 1.5.1-3 [28.3 kB]
Get:8 http://172.17.0.1/private bullseye-staging/main armhf man-db armhf 2.9.0-2 [1261 kB]
Get:9 http://172.17.0.1/private bullseye-staging/main armhf libssl1.1 armhf 1.1.1d-2 [1268 kB]
Get:10 http://172.17.0.1/private bullseye-staging/main armhf libpython3.7-minimal armhf 3.7.5-2 [584 kB]
Get:11 http://172.17.0.1/private bullseye-staging/main armhf libexpat1 armhf 2.2.9-1 [71.5 kB]
Get:12 http://172.17.0.1/private bullseye-staging/main armhf python3.7-minimal armhf 3.7.5-2 [1527 kB]
Get:13 http://172.17.0.1/private bullseye-staging/main armhf python3-minimal armhf 3.7.5-1 [36.6 kB]
Get:14 http://172.17.0.1/private bullseye-staging/main armhf mime-support all 3.64 [37.8 kB]
Get:15 http://172.17.0.1/private bullseye-staging/main armhf libmpdec2 armhf 2.4.2-2 [67.2 kB]
Get:16 http://172.17.0.1/private bullseye-staging/main armhf libpython3.7-stdlib armhf 3.7.5-2 [1668 kB]
Get:17 http://172.17.0.1/private bullseye-staging/main armhf python3.7 armhf 3.7.5-2 [347 kB]
Get:18 http://172.17.0.1/private bullseye-staging/main armhf libpython3-stdlib armhf 3.7.5-1 [20.1 kB]
Get:19 http://172.17.0.1/private bullseye-staging/main armhf python3 armhf 3.7.5-1 [61.5 kB]
Get:20 http://172.17.0.1/private bullseye-staging/main armhf sensible-utils all 0.0.12+nmu1 [16.0 kB]
Get:21 http://172.17.0.1/private bullseye-staging/main armhf libmagic-mgc armhf 1:5.37-6 [253 kB]
Get:22 http://172.17.0.1/private bullseye-staging/main armhf libmagic1 armhf 1:5.37-6 [111 kB]
Get:23 http://172.17.0.1/private bullseye-staging/main armhf file armhf 1:5.37-6 [66.2 kB]
Get:24 http://172.17.0.1/private bullseye-staging/main armhf gettext-base armhf 0.19.8.1-10 [117 kB]
Get:25 http://172.17.0.1/private bullseye-staging/main armhf libsigsegv2 armhf 2.12-2 [32.3 kB]
Get:26 http://172.17.0.1/private bullseye-staging/main armhf m4 armhf 1.4.18-4 [185 kB]
Get:27 http://172.17.0.1/private bullseye-staging/main armhf autoconf all 2.69-11 [341 kB]
Get:28 http://172.17.0.1/private bullseye-staging/main armhf autotools-dev all 20180224.1 [77.0 kB]
Get:29 http://172.17.0.1/private bullseye-staging/main armhf automake all 1:1.16.1-4 [771 kB]
Get:30 http://172.17.0.1/private bullseye-staging/main armhf autopoint all 0.19.8.1-10 [435 kB]
Get:31 http://172.17.0.1/private bullseye-staging/main armhf libtool all 2.4.6-11 [547 kB]
Get:32 http://172.17.0.1/private bullseye-staging/main armhf dh-autoreconf all 19 [16.9 kB]
Get:33 http://172.17.0.1/private bullseye-staging/main armhf libdebhelper-perl all 12.7.2 [174 kB]
Get:34 http://172.17.0.1/private bullseye-staging/main armhf libarchive-zip-perl all 1.67-1 [104 kB]
Get:35 http://172.17.0.1/private bullseye-staging/main armhf libsub-override-perl all 0.09-2 [10.2 kB]
Get:36 http://172.17.0.1/private bullseye-staging/main armhf libfile-stripnondeterminism-perl all 1.6.3-1 [23.6 kB]
Get:37 http://172.17.0.1/private bullseye-staging/main armhf dh-strip-nondeterminism all 1.6.3-1 [14.6 kB]
Get:38 http://172.17.0.1/private bullseye-staging/main armhf libelf1 armhf 0.176-1.1 [158 kB]
Get:39 http://172.17.0.1/private bullseye-staging/main armhf dwz armhf 0.13-5 [142 kB]
Get:40 http://172.17.0.1/private bullseye-staging/main armhf libglib2.0-0 armhf 2.62.3-2 [1137 kB]
Get:41 http://172.17.0.1/private bullseye-staging/main armhf libicu63 armhf 63.2-2 [7974 kB]
Get:42 http://172.17.0.1/private bullseye-staging/main armhf libxml2 armhf 2.9.4+dfsg1-8 [593 kB]
Get:43 http://172.17.0.1/private bullseye-staging/main armhf libcroco3 armhf 0.6.13-1 [133 kB]
Get:44 http://172.17.0.1/private bullseye-staging/main armhf gettext armhf 0.19.8.1-10 [1219 kB]
Get:45 http://172.17.0.1/private bullseye-staging/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB]
Get:46 http://172.17.0.1/private bullseye-staging/main armhf po-debconf all 1.0.21 [248 kB]
Get:47 http://172.17.0.1/private bullseye-staging/main armhf debhelper all 12.7.2 [1018 kB]
Get:48 http://172.17.0.1/private bullseye-staging/main armhf markdown all 1.0.1-10 [17.4 kB]
Get:49 http://172.17.0.1/private bullseye-staging/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-1 [206 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 24.6 MB in 2s (10.0 MB/s)
Selecting previously unselected package libbsd0:armhf.
(Reading database ... 13002 files and directories currently installed.)
Preparing to unpack .../00-libbsd0_0.10.0-1_armhf.deb ...
Unpacking libbsd0:armhf (0.10.0-1) ...
Selecting previously unselected package libtinfo5:armhf.
Preparing to unpack .../01-libtinfo5_6.1+20191019-1_armhf.deb ...
Unpacking libtinfo5:armhf (6.1+20191019-1) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../02-bsdmainutils_11.1.2_armhf.deb ...
Unpacking bsdmainutils (11.1.2) ...
Selecting previously unselected package libuchardet0:armhf.
Preparing to unpack .../03-libuchardet0_0.0.6-3_armhf.deb ...
Unpacking libuchardet0:armhf (0.0.6-3) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../04-groff-base_1.22.4-3_armhf.deb ...
Unpacking groff-base (1.22.4-3) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../05-libpipeline1_1.5.1-3_armhf.deb ...
Unpacking libpipeline1:armhf (1.5.1-3) ...
Selecting previously unselected package man-db.
Preparing to unpack .../06-man-db_2.9.0-2_armhf.deb ...
Unpacking man-db (2.9.0-2) ...
Selecting previously unselected package libssl1.1:armhf.
Preparing to unpack .../07-libssl1.1_1.1.1d-2_armhf.deb ...
Unpacking libssl1.1:armhf (1.1.1d-2) ...
Selecting previously unselected package libpython3.7-minimal:armhf.
Preparing to unpack .../08-libpython3.7-minimal_3.7.5-2_armhf.deb ...
Unpacking libpython3.7-minimal:armhf (3.7.5-2) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../09-libexpat1_2.2.9-1_armhf.deb ...
Unpacking libexpat1:armhf (2.2.9-1) ...
Selecting previously unselected package python3.7-minimal.
Preparing to unpack .../10-python3.7-minimal_3.7.5-2_armhf.deb ...
Unpacking python3.7-minimal (3.7.5-2) ...
Setting up libssl1.1:armhf (1.1.1d-2) ...
Setting up libpython3.7-minimal:armhf (3.7.5-2) ...
Setting up libexpat1:armhf (2.2.9-1) ...
Setting up python3.7-minimal (3.7.5-2) ...
Selecting previously unselected package python3-minimal.
(Reading database ... 13922 files and directories currently installed.)
Preparing to unpack .../0-python3-minimal_3.7.5-1_armhf.deb ...
Unpacking python3-minimal (3.7.5-1) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../1-mime-support_3.64_all.deb ...
Unpacking mime-support (3.64) ...
Selecting previously unselected package libmpdec2:armhf.
Preparing to unpack .../2-libmpdec2_2.4.2-2_armhf.deb ...
Unpacking libmpdec2:armhf (2.4.2-2) ...
Selecting previously unselected package libpython3.7-stdlib:armhf.
Preparing to unpack .../3-libpython3.7-stdlib_3.7.5-2_armhf.deb ...
Unpacking libpython3.7-stdlib:armhf (3.7.5-2) ...
Selecting previously unselected package python3.7.
Preparing to unpack .../4-python3.7_3.7.5-2_armhf.deb ...
Unpacking python3.7 (3.7.5-2) ...
Selecting previously unselected package libpython3-stdlib:armhf.
Preparing to unpack .../5-libpython3-stdlib_3.7.5-1_armhf.deb ...
Unpacking libpython3-stdlib:armhf (3.7.5-1) ...
Setting up python3-minimal (3.7.5-1) ...
Selecting previously unselected package python3.
(Reading database ... 14360 files and directories currently installed.)
Preparing to unpack .../00-python3_3.7.5-1_armhf.deb ...
Unpacking python3 (3.7.5-1) ...
Selecting previously unselected package sensible-utils.
Preparing to unpack .../01-sensible-utils_0.0.12+nmu1_all.deb ...
Unpacking sensible-utils (0.0.12+nmu1) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../02-libmagic-mgc_1%3a5.37-6_armhf.deb ...
Unpacking libmagic-mgc (1:5.37-6) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../03-libmagic1_1%3a5.37-6_armhf.deb ...
Unpacking libmagic1:armhf (1:5.37-6) ...
Selecting previously unselected package file.
Preparing to unpack .../04-file_1%3a5.37-6_armhf.deb ...
Unpacking file (1:5.37-6) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../05-gettext-base_0.19.8.1-10_armhf.deb ...
Unpacking gettext-base (0.19.8.1-10) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../06-libsigsegv2_2.12-2_armhf.deb ...
Unpacking libsigsegv2:armhf (2.12-2) ...
Selecting previously unselected package m4.
Preparing to unpack .../07-m4_1.4.18-4_armhf.deb ...
Unpacking m4 (1.4.18-4) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../08-autoconf_2.69-11_all.deb ...
Unpacking autoconf (2.69-11) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../09-autotools-dev_20180224.1_all.deb ...
Unpacking autotools-dev (20180224.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../10-automake_1%3a1.16.1-4_all.deb ...
Unpacking automake (1:1.16.1-4) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../11-autopoint_0.19.8.1-10_all.deb ...
Unpacking autopoint (0.19.8.1-10) ...
Selecting previously unselected package libtool.
Preparing to unpack .../12-libtool_2.4.6-11_all.deb ...
Unpacking libtool (2.4.6-11) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../13-dh-autoreconf_19_all.deb ...
Unpacking dh-autoreconf (19) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../14-libdebhelper-perl_12.7.2_all.deb ...
Unpacking libdebhelper-perl (12.7.2) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../15-libarchive-zip-perl_1.67-1_all.deb ...
Unpacking libarchive-zip-perl (1.67-1) ...
Selecting previously unselected package libsub-override-perl.
Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ...
Unpacking libsub-override-perl (0.09-2) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.6.3-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.6.3-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../18-dh-strip-nondeterminism_1.6.3-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.6.3-1) ...
Selecting previously unselected package libelf1:armhf.
Preparing to unpack .../19-libelf1_0.176-1.1_armhf.deb ...
Unpacking libelf1:armhf (0.176-1.1) ...
Selecting previously unselected package dwz.
Preparing to unpack .../20-dwz_0.13-5_armhf.deb ...
Unpacking dwz (0.13-5) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../21-libglib2.0-0_2.62.3-2_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.62.3-2) ...
Selecting previously unselected package libicu63:armhf.
Preparing to unpack .../22-libicu63_63.2-2_armhf.deb ...
Unpacking libicu63:armhf (63.2-2) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../23-libxml2_2.9.4+dfsg1-8_armhf.deb ...
Unpacking libxml2:armhf (2.9.4+dfsg1-8) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../24-libcroco3_0.6.13-1_armhf.deb ...
Unpacking libcroco3:armhf (0.6.13-1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../25-gettext_0.19.8.1-10_armhf.deb ...
Unpacking gettext (0.19.8.1-10) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../26-intltool-debian_0.35.0+20060710.5_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.5) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../27-po-debconf_1.0.21_all.deb ...
Unpacking po-debconf (1.0.21) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../28-debhelper_12.7.2_all.deb ...
Unpacking debhelper (12.7.2) ...
Selecting previously unselected package markdown.
Preparing to unpack .../29-markdown_1.0.1-10_all.deb ...
Unpacking markdown (1.0.1-10) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../30-zlib1g-dev_1%3a1.2.11.dfsg-1_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-1) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../31-sbuild-build-depends-seqprep-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up libpipeline1:armhf (1.5.1-3) ...
Setting up mime-support (3.64) ...
Setting up libmagic-mgc (1:5.37-6) ...
Setting up libarchive-zip-perl (1.67-1) ...
Setting up libglib2.0-0:armhf (2.62.3-2) ...
No schema files found: doing nothing.
Setting up libdebhelper-perl (12.7.2) ...
Setting up libmagic1:armhf (1:5.37-6) ...
Setting up gettext-base (0.19.8.1-10) ...
Setting up file (1:5.37-6) ...
Setting up libicu63:armhf (63.2-2) ...
Setting up autotools-dev (20180224.1) ...
Setting up libsigsegv2:armhf (2.12-2) ...
Setting up autopoint (0.19.8.1-10) ...
Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-1) ...
Setting up sensible-utils (0.0.12+nmu1) ...
Setting up libuchardet0:armhf (0.0.6-3) ...
Setting up libsub-override-perl (0.09-2) ...
Setting up libmpdec2:armhf (2.4.2-2) ...
Setting up libbsd0:armhf (0.10.0-1) ...
Setting up libtinfo5:armhf (6.1+20191019-1) ...
Setting up libelf1:armhf (0.176-1.1) ...
Setting up libxml2:armhf (2.9.4+dfsg1-8) ...
Setting up markdown (1.0.1-10) ...
Setting up libfile-stripnondeterminism-perl (1.6.3-1) ...
Setting up libpython3.7-stdlib:armhf (3.7.5-2) ...
Setting up libtool (2.4.6-11) ...
Setting up m4 (1.4.18-4) ...
Setting up bsdmainutils (11.1.2) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up libcroco3:armhf (0.6.13-1) ...
Setting up autoconf (2.69-11) ...
Setting up dh-strip-nondeterminism (1.6.3-1) ...
Setting up dwz (0.13-5) ...
Setting up groff-base (1.22.4-3) ...
Setting up libpython3-stdlib:armhf (3.7.5-1) ...
Setting up automake (1:1.16.1-4) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up python3.7 (3.7.5-2) ...
Setting up gettext (0.19.8.1-10) ...
Setting up python3 (3.7.5-1) ...
Setting up man-db (2.9.0-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up intltool-debian (0.35.0+20060710.5) ...
Setting up po-debconf (1.0.21) ...
Setting up dh-autoreconf (19) ...
Setting up debhelper (12.7.2) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.29-3+rpi1) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 4.9.0-0.bpo.6-armmp armhf (armv7l)
Toolchain package versions: binutils_2.33.1-5+rpi1 dpkg-dev_1.19.7 g++-9_9.2.1-19+rpi1+b1 gcc-9_9.2.1-19+rpi1+b1 libc6-dev_2.29-3+rpi1 libstdc++-9-dev_9.2.1-19+rpi1+b1 libstdc++6_9.2.1-19+rpi1+b1 linux-libc-dev_5.2.17-1+rpi1+b2
Package versions: adduser_3.118 apt_1.8.4 autoconf_2.69-11 automake_1:1.16.1-4 autopoint_0.19.8.1-10 autotools-dev_20180224.1 base-files_11+rpi1 base-passwd_3.5.46 bash_5.0-5 binutils_2.33.1-5+rpi1 binutils-arm-linux-gnueabihf_2.33.1-5+rpi1 binutils-common_2.33.1-5+rpi1 bsdmainutils_11.1.2 bsdutils_1:2.34-0.1 build-essential_12.8 bzip2_1.0.8-2 coreutils_8.30-3 cpp_4:9.2.1-3.1+rpi1 cpp-9_9.2.1-19+rpi1+b1 dash_0.5.10.2-6 debconf_1.5.73 debhelper_12.7.2 debianutils_4.9 dh-autoreconf_19 dh-strip-nondeterminism_1.6.3-1 diffutils_1:3.7-3 dirmngr_2.2.17-3+b1 dpkg_1.19.7 dpkg-dev_1.19.7 dwz_0.13-5 e2fsprogs_1.45.4-1 fakeroot_1.24-1 fdisk_2.34-0.1 file_1:5.37-6 findutils_4.7.0-1 g++_4:9.2.1-3.1+rpi1 g++-9_9.2.1-19+rpi1+b1 gcc_4:9.2.1-3.1+rpi1 gcc-9_9.2.1-19+rpi1+b1 gcc-9-base_9.2.1-19+rpi1+b1 gettext_0.19.8.1-10 gettext-base_0.19.8.1-10 gnupg_2.2.17-3 gnupg-l10n_2.2.17-3 gnupg-utils_2.2.17-3+b1 gpg_2.2.17-3+b1 gpg-agent_2.2.17-3+b1 gpg-wks-client_2.2.17-3+b1 gpg-wks-server_2.2.17-3+b1 gpgconf_2.2.17-3+b1 gpgsm_2.2.17-3+b1 gpgv_2.2.17-3+b1 grep_3.3-1 groff-base_1.22.4-3 gzip_1.9-3 hostname_3.23 init-system-helpers_1.57 intltool-debian_0.35.0+20060710.5 iputils-ping_3:20190709-2 libacl1_2.2.53-5 libapt-pkg5.0_1.8.4 libarchive-zip-perl_1.67-1 libasan5_9.2.1-19+rpi1+b1 libassuan0_2.5.3-7 libatomic1_9.2.1-19+rpi1+b1 libattr1_1:2.4.48-5 libaudit-common_1:2.8.5-2 libaudit1_1:2.8.5-2+b1 libbinutils_2.33.1-5+rpi1 libblkid1_2.34-0.1 libbsd0_0.10.0-1 libbz2-1.0_1.0.8-2 libc-bin_2.29-3+rpi1 libc-dev-bin_2.29-3+rpi1 libc6_2.29-3+rpi1 libc6-dev_2.29-3+rpi1 libcap-ng0_0.7.9-2.1 libcap2_1:2.27-1 libcap2-bin_1:2.27-1 libcc1-0_9.2.1-19+rpi1+b1 libcom-err2_1.45.4-1 libcroco3_0.6.13-1 libdb5.3_5.3.28+dfsg1-0.6 libdebconfclient0_0.250 libdebhelper-perl_12.7.2 libdpkg-perl_1.19.7 libelf1_0.176-1.1 libexpat1_2.2.9-1 libext2fs2_1.45.4-1 libfakeroot_1.24-1 libfdisk1_2.34-0.1 libffi6_3.2.1-9 libfile-stripnondeterminism-perl_1.6.3-1 libgcc-9-dev_9.2.1-19+rpi1+b1 libgcc1_1:9.2.1-19+rpi1+b1 libgcrypt20_1.8.5-3 libgdbm-compat4_1.18.1-5 libgdbm6_1.18.1-5 libglib2.0-0_2.62.3-2 libgmp10_2:6.1.2+dfsg-4 libgnutls30_3.6.10-5 libgomp1_9.2.1-19+rpi1+b1 libgpg-error0_1.36-7 libhogweed5_3.5.1+really3.5.1-2 libicu63_63.2-2 libidn2-0_2.2.0-2 libisl22_0.22-2 libksba8_1.3.5-2 libldap-2.4-2_2.4.48+dfsg-1+b2 libldap-common_2.4.48+dfsg-1 liblz4-1_1.9.2-2 liblzma5_5.2.4-1 libmagic-mgc_1:5.37-6 libmagic1_1:5.37-6 libmount1_2.34-0.1 libmpc3_1.1.0-1 libmpdec2_2.4.2-2 libmpfr6_4.0.2-1 libncursesw6_6.1+20191019-1 libnettle7_3.5.1+really3.5.1-2 libnpth0_1.6-1 libp11-kit0_0.23.18.1-2 libpam-cap_1:2.27-1 libpam-modules_1.3.1-5 libpam-modules-bin_1.3.1-5 libpam-runtime_1.3.1-5 libpam0g_1.3.1-5 libpcre2-8-0_10.34-3 libpcre3_2:8.39-12 libperl5.30_5.30.0-9 libpipeline1_1.5.1-3 libpython3-stdlib_3.7.5-1 libpython3.7-minimal_3.7.5-2 libpython3.7-stdlib_3.7.5-2 libreadline7_7.0-5 libreadline8_8.0-3 librust-bitflags-dev_1.2.1-1 librust-cloudabi+default-dev_0.0.3-1 librust-cloudabi-dev_0.0.3-1 librust-fuchsia-zircon-dev_0.3.3-2 librust-fuchsia-zircon-sys-dev_0.3.3-2 librust-libc-dev_0.2.62-1 librust-phf-codegen-dev_0.7.23-1 librust-phf-generator-dev_0.7.23-1 librust-phf-shared-dev_0.7.23-2+b1 librust-rand-0.5+alloc-dev_0.5.5-2+rpi1 librust-rand-0.5+std-dev_0.5.5-2+rpi1 librust-rand-0.5-dev_0.5.5-2+rpi1 librust-rand-core-0.2+alloc-dev_0.2.2-1 librust-rand-core-0.2+std-dev_0.2.2-1 librust-rand-core-0.2-dev_0.2.2-1 librust-rand-core-dev_0.3.0-1 librust-siphasher-dev_0.2.3-1 librust-winapi-dev_0.3.6-1 librust-winapi-i686-pc-windows-gnu-dev_0.4.0-1 librust-winapi-x86-64-pc-windows-gnu-dev_0.4.0-1 libsasl2-2_2.1.27+dfsg-1+b1 libsasl2-modules-db_2.1.27+dfsg-1+b1 libseccomp2_2.4.2-2+rpi1 libselinux1_2.9-3 libsemanage-common_2.9-3 libsemanage1_2.9-3 libsepol1_2.9-2 libsigsegv2_2.12-2 libsmartcols1_2.34-0.1 libsqlite3-0_3.30.1-1 libss2_1.45.4-1 libssl1.1_1.1.1d-2 libstdc++-9-dev_9.2.1-19+rpi1+b1 libstdc++6_9.2.1-19+rpi1+b1 libsub-override-perl_0.09-2 libsystemd0_243-8+rpi1 libtasn1-6_4.14-3 libtinfo5_6.1+20191019-1 libtinfo6_6.1+20191019-1 libtool_2.4.6-11 libubsan1_9.2.1-19+rpi1+b1 libuchardet0_0.0.6-3 libudev1_243-8+rpi1 libunistring2_0.9.10-2 libuuid1_2.34-0.1 libxml2_2.9.4+dfsg1-8 libzstd1_1.4.4+dfsg-1+rpi1 linux-libc-dev_5.2.17-1+rpi1+b2 login_1:4.7-2 logsave_1.45.4-1 lsb-base_11.1.0+rpi1 m4_1.4.18-4 make_4.2.1-1.2 man-db_2.9.0-2 markdown_1.0.1-10 mawk_1.3.3-17 mime-support_3.64 mount_2.34-0.1 ncurses-base_6.1+20191019-1 ncurses-bin_6.1+20191019-1 netbase_5.7 passwd_1:4.7-2 patch_2.7.6-6 perl_5.30.0-9 perl-base_5.30.0-9 perl-modules-5.30_5.30.0-9 pinentry-curses_1.1.0-3 po-debconf_1.0.21 python3_3.7.5-1 python3-minimal_3.7.5-1 python3.7_3.7.5-2 python3.7-minimal_3.7.5-2 raspbian-archive-keyring_20120528.2 readline-common_8.0-3 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.7-1 sensible-utils_0.0.12+nmu1 sysvinit-utils_2.96-1 tar_1.30+dfsg-6 tzdata_2019c-3 util-linux_2.34-0.1 xz-utils_5.2.4-1 zlib1g_1:1.2.11.dfsg-1 zlib1g-dev_1:1.2.11.dfsg-1
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/sbuild-nonexistent/.gnupg/trustedkeys.kbx': General error
gpgv: Signature made Tue Dec 17 12:10:01 2019 UTC
gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv: issuer "tille@debian.org"
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-4.dsc
dpkg-source: info: extracting seqprep in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.3.2-4.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
dpkg-source: info: applying 2to3.patch
Check disc space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=bullseye-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=bullseye-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=bullseye-staging-armhf-sbuild-8d6ac0b9-2684-4556-afca-f6fbc3df93cf
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=linux
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: info: source package seqprep
dpkg-buildpackage: info: source version 1.3.2-4
dpkg-buildpackage: info: source distribution unstable
dpkg-source --before-build .
dpkg-buildpackage: info: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_auto_clean
make -j4 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
rm -f SeqPrep.o utils.o stdaln.o SeqPrep
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean
rm -f seqprep
rm -f README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules build-arch
dh build-arch
dh_update_autotools_config -a
dh_autoreconf -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build
make -j4 "INSTALL=install --strip-program=true"
make[2]: Entering directory '/<<PKGBUILDDIR>>'
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o
SeqPrep.c: In function 'main':
SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration]
166 | while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) {
| ^~~~~~
cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
cp SeqPrep seqprep
markdown README.md > README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.926789
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.824265
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python3 seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python3 seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python3 seqlens.py
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python3 seqlens.py
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python3 seqlens.py
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
create-stamp debian/debhelper-build-stamp
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j4 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true"
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
make[1]: [Makefile:15: install] Error 1 (ignored)
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_strip_nondeterminism -a
dh_compress -a
dh_fixperms -a
dh_missing -a
dh_dwz -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dpkg-shlibdeps: warning: package could avoid a useless dependency if debian/seqprep/usr/bin/seqprep was not linked against ld-linux-armhf.so.3 (it uses none of the library's symbols)
dh_installdeb -a
dh_gencontrol -a
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-4_armhf.deb'.
dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-4_armhf.deb'.
dpkg-genbuildinfo --build=any
dpkg-genchanges --build=any -mRaspbian wandboard test autobuilder <root@raspbian.org> >../seqprep_1.3.2-4_armhf.changes
dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build .
dpkg-buildpackage: info: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 2019-12-19T05:19:05Z
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
seqprep_1.3.2-4_armhf.changes:
------------------------------
Format: 1.8
Date: Tue, 17 Dec 2019 12:52:12 +0100
Source: seqprep
Binary: seqprep seqprep-dbgsym
Architecture: armhf
Version: 1.3.2-4
Distribution: bullseye-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
Closes: 938467
Changes:
seqprep (1.3.2-4) unstable; urgency=medium
.
* Replace python-markdown by markdown
* Use 2to3 to port from Python2 to Python3
Closes: #938467
* debhelper-compat 12
* Standards-Version: 4.4.1
* Respect DEB_BUILD_OPTIONS in override_dh_auto_test target
* Remove trailing whitespace in debian/changelog
* autopkgtest: s/ADTTMP/AUTOPKGTEST_TMP/g
* Set upstream metadata fields: Bug-Database, Repository, Repository-
Browse.
* Do not call ronn for every build just to rebuild manpage - rather
provide manpage itself
Checksums-Sha1:
961575aceff8b75493262a0b18a94d6a5b3863d5 18644 seqprep-dbgsym_1.3.2-4_armhf.deb
ef314da7234648d656575601cc3c7eb8dcbe174b 4965 seqprep_1.3.2-4_armhf.buildinfo
006e1e055beef42168d663e5f14411e66890134c 26948 seqprep_1.3.2-4_armhf.deb
Checksums-Sha256:
0827b827591f4634f095abe6dbe52859fef90e8327406db42c8421acefbbac69 18644 seqprep-dbgsym_1.3.2-4_armhf.deb
0d0900220bece459be2b099da1c4b5682c869c19461236cf6f6bd09a411bf9d1 4965 seqprep_1.3.2-4_armhf.buildinfo
6df53f64f655d7219c767c7ffe350d75933ab3d45bae04fc450c625829eb674d 26948 seqprep_1.3.2-4_armhf.deb
Files:
7cfb51a737bad18f8773faa39b86652a 18644 debug optional seqprep-dbgsym_1.3.2-4_armhf.deb
f67de4401e3617881cdbc558f7ba87b9 4965 science optional seqprep_1.3.2-4_armhf.buildinfo
3033f7db90638fd8c8d1aae978f45ade 26948 science optional seqprep_1.3.2-4_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
seqprep-dbgsym_1.3.2-4_armhf.deb
--------------------------------
new Debian package, version 2.0.
size 18644 bytes: control archive=536 bytes.
369 bytes, 12 lines control
106 bytes, 1 lines md5sums
Package: seqprep-dbgsym
Source: seqprep
Version: 1.3.2-4
Auto-Built-Package: debug-symbols
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 34
Depends: seqprep (= 1.3.2-4)
Section: debug
Priority: optional
Description: debug symbols for seqprep
Build-Ids: e362b4e5dedcac666c6d37b49bd9c4e3390d1741
drwxr-xr-x root/root 0 2019-12-17 11:52 ./
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/lib/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/lib/debug/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/lib/debug/.build-id/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/lib/debug/.build-id/e3/
-rw-r--r-- root/root 23712 2019-12-17 11:52 ./usr/lib/debug/.build-id/e3/62b4e5dedcac666c6d37b49bd9c4e3390d1741.debug
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/doc/
lrwxrwxrwx root/root 0 2019-12-17 11:52 ./usr/share/doc/seqprep-dbgsym -> seqprep
seqprep_1.3.2-4_armhf.deb
-------------------------
new Debian package, version 2.0.
size 26948 bytes: control archive=1108 bytes.
1172 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.3.2-4
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 103
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2019-12-17 11:52 ./
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/bin/
-rwxr-xr-x root/root 74224 2019-12-17 11:52 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/doc/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11784 2019-12-17 11:52 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 1278 2019-12-17 11:52 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1439 2019-12-17 11:52 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/man/
drwxr-xr-x root/root 0 2019-12-17 11:52 ./usr/share/man/man1/
-rw-r--r-- root/root 4566 2019-12-17 11:52 ./usr/share/man/man1/seqprep.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 65020
Build-Time: 268
Distribution: bullseye-staging
Host Architecture: armhf
Install-Time: 416
Job: seqprep_1.3.2-4
Machine Architecture: armhf
Package: seqprep
Package-Time: 744
Source-Version: 1.3.2-4
Space: 65020
Status: successful
Version: 1.3.2-4
--------------------------------------------------------------------------------
Finished at 2019-12-19T05:19:05Z
Build needed 00:12:24, 65020k disc space