seqprep →
1.3.2-3 →
armhf → 2018-07-11 06:03:49
sbuild (Debian sbuild) 0.72.0 (25 Oct 2016) on mb-lxc-02
+==============================================================================+
| seqprep 1.3.2-3 (armhf) Wed, 11 Jul 2018 05:57:14 +0000 |
+==============================================================================+
Package: seqprep
Version: 1.3.2-3
Source Version: 1.3.2-3
Distribution: buster-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/buster-staging-armhf-sbuild-fb504a14-b640-472f-880b-d209ac6f31c9' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private buster-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private buster-staging/main Sources [10.9 MB]
Get:3 http://172.17.0.1/private buster-staging/main armhf Packages [12.6 MB]
Fetched 23.5 MB in 9s (2626 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at:
https://salsa.debian.org/med-team/seqprep.git
Please use:
git clone https://salsa.debian.org/med-team/seqprep.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-3 (dsc) [2111 B]
Get:2 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-3 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-3 (diff) [9364 B]
Fetched 37.2 MB in 9s (4360 kB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/seqprep-KVlaJD/seqprep-1.3.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/seqprep-KVlaJD' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install build-essential |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-g1D9sg/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-g1D9sg/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-g1D9sg/gpg/trustdb.gpg: trustdb created
gpg: key 37145E60F90AF620: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg: imported: 1
gpg: key 37145E60F90AF620: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 37145E60F90AF620: secret key imported
gpg: Total number processed: 1
gpg: unchanged: 1
gpg: secret keys read: 1
gpg: secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Packages [432 B]
Fetched 2108 B in 0s (11.6 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install core build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
ca-certificates dbus dbus-user-session e2fsprogs-l10n libexpat1
libnss-systemd libpam-systemd libsasl2-modules libssl1.1 openssl
systemd-sysv
Use 'apt autoremove' to remove them.
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 39 not upgraded.
Need to get 848 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [848 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 848 B in 0s (0 B/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 15728 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (armhf included in any all)
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev
Filtered Build-Depends: debhelper (>= 11~), python, python-markdown, ronn, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<<BUILDDIR>>/resolver-g1D9sg/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy sbuild-build-depends-seqprep-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Sources [520 B]
Get:5 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ Packages [597 B]
Fetched 2450 B in 0s (13.4 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install seqprep build dependencies (apt-based resolver)
-------------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
dbus dbus-user-session e2fsprogs-l10n libnss-systemd libpam-systemd
libsasl2-modules systemd-sysv
Use 'apt autoremove' to remove them.
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils debhelper
dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff
groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3 libelf1
libfile-stripnondeterminism-perl libfreetype6 libglib2.0-0 libgraphite2-3
libharfbuzz0b libice6 libicu-le-hb0 libicu60 libmagic-mgc libmagic1
libmarkdown2 libpipeline1 libpython-stdlib libpython2-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.5 libsigsegv2 libsm6
libtimedate-perl libtool libx11-6 libx11-data libxau6 libxaw7 libxcb1
libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6 libyaml-0-2 m4 man-db
mime-support po-debconf python python-markdown python-minimal python2
python2-minimal python2.7 python2.7-minimal rake ronn ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby-xmlrpc
ruby2.5 rubygems-integration x11-common zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
vacation dh-make gettext-doc libasprintf-dev libgettextpo-dev libtool-doc
gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser
libmail-box-perl python-doc python-tk python-markdown-doc python2-doc
python2.7-doc binfmt-support ri ruby-dev bundler
Recommended packages:
curl | wget | lynx ghostscript imagemagick libpaper1 netpbm psutils
libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs
libltdl-dev libmail-sendmail-perl python-pygments python-yaml zip fonts-lato
libjs-jquery
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils debhelper
dh-autoreconf dh-strip-nondeterminism dwz file gettext gettext-base groff
groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3 libelf1
libfile-stripnondeterminism-perl libfreetype6 libglib2.0-0 libgraphite2-3
libharfbuzz0b libice6 libicu-le-hb0 libicu60 libmagic-mgc libmagic1
libmarkdown2 libpipeline1 libpython-stdlib libpython2-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.5 libsigsegv2 libsm6
libtimedate-perl libtool libx11-6 libx11-data libxau6 libxaw7 libxcb1
libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6 libyaml-0-2 m4 man-db
mime-support po-debconf python python-markdown python-minimal python2
python2-minimal python2.7 python2.7-minimal rake ronn ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby-xmlrpc
ruby2.5 rubygems-integration sbuild-build-depends-seqprep-dummy x11-common
zlib1g-dev
0 upgraded, 82 newly installed, 0 to remove and 39 not upgraded.
Need to get 32.6 MB/34.0 MB of archives.
After this operation, 115 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-g1D9sg/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [880 B]
Get:2 http://172.17.0.1/private buster-staging/main armhf libbsd0 armhf 0.9.1-1 [104 kB]
Get:3 http://172.17.0.1/private buster-staging/main armhf bsdmainutils armhf 11.1.2 [182 kB]
Get:4 http://172.17.0.1/private buster-staging/main armhf groff-base armhf 1.22.3-10 [1005 kB]
Get:5 http://172.17.0.1/private buster-staging/main armhf libpipeline1 armhf 1.5.0-1 [24.6 kB]
Get:6 http://172.17.0.1/private buster-staging/main armhf man-db armhf 2.8.3-2 [1146 kB]
Get:7 http://172.17.0.1/private buster-staging/main armhf libpython2.7-minimal armhf 2.7.15-1 [393 kB]
Get:8 http://172.17.0.1/private buster-staging/main armhf python2.7-minimal armhf 2.7.15-1 [1077 kB]
Get:9 http://172.17.0.1/private buster-staging/main armhf python2-minimal armhf 2.7.15-3 [41.3 kB]
Get:10 http://172.17.0.1/private buster-staging/main armhf python-minimal armhf 2.7.15-3 [20.9 kB]
Get:11 http://172.17.0.1/private buster-staging/main armhf mime-support all 3.61 [37.1 kB]
Get:12 http://172.17.0.1/private buster-staging/main armhf libpython2.7-stdlib armhf 2.7.15-1 [1841 kB]
Get:13 http://172.17.0.1/private buster-staging/main armhf python2.7 armhf 2.7.15-1 [298 kB]
Get:14 http://172.17.0.1/private buster-staging/main armhf libpython2-stdlib armhf 2.7.15-3 [20.7 kB]
Get:15 http://172.17.0.1/private buster-staging/main armhf libpython-stdlib armhf 2.7.15-3 [20.7 kB]
Get:16 http://172.17.0.1/private buster-staging/main armhf python2 armhf 2.7.15-3 [41.5 kB]
Get:17 http://172.17.0.1/private buster-staging/main armhf python armhf 2.7.15-3 [22.7 kB]
Get:18 http://172.17.0.1/private buster-staging/main armhf libmagic-mgc armhf 1:5.33-3 [234 kB]
Get:19 http://172.17.0.1/private buster-staging/main armhf libmagic1 armhf 1:5.33-3 [106 kB]
Get:20 http://172.17.0.1/private buster-staging/main armhf file armhf 1:5.33-3 [64.7 kB]
Get:21 http://172.17.0.1/private buster-staging/main armhf gettext-base armhf 0.19.8.1-6 [117 kB]
Get:22 http://172.17.0.1/private buster-staging/main armhf libsigsegv2 armhf 2.12-2 [32.3 kB]
Get:23 http://172.17.0.1/private buster-staging/main armhf m4 armhf 1.4.18-1 [185 kB]
Get:24 http://172.17.0.1/private buster-staging/main armhf autoconf all 2.69-11 [341 kB]
Get:25 http://172.17.0.1/private buster-staging/main armhf autotools-dev all 20180224.1 [77.0 kB]
Get:26 http://172.17.0.1/private buster-staging/main armhf automake all 1:1.15.1-3.1 [736 kB]
Get:27 http://172.17.0.1/private buster-staging/main armhf autopoint all 0.19.8.1-6 [434 kB]
Get:28 http://172.17.0.1/private buster-staging/main armhf libtool all 2.4.6-2.1 [547 kB]
Get:29 http://172.17.0.1/private buster-staging/main armhf dh-autoreconf all 19 [16.9 kB]
Get:30 http://172.17.0.1/private buster-staging/main armhf libarchive-zip-perl all 1.60-1 [95.6 kB]
Get:31 http://172.17.0.1/private buster-staging/main armhf libfile-stripnondeterminism-perl all 0.042-1 [20.1 kB]
Get:32 http://172.17.0.1/private buster-staging/main armhf libtimedate-perl all 2.3000-2 [42.2 kB]
Get:33 http://172.17.0.1/private buster-staging/main armhf dh-strip-nondeterminism all 0.042-1 [12.1 kB]
Get:34 http://172.17.0.1/private buster-staging/main armhf libelf1 armhf 0.170-0.5 [160 kB]
Get:35 http://172.17.0.1/private buster-staging/main armhf dwz armhf 0.12-2 [67.4 kB]
Get:36 http://172.17.0.1/private buster-staging/main armhf libglib2.0-0 armhf 2.56.1-2 [2754 kB]
Get:37 http://172.17.0.1/private buster-staging/main armhf libharfbuzz0b armhf 1.8.2-2 [832 kB]
Get:38 http://172.17.0.1/private buster-staging/main armhf libicu-le-hb0 armhf 1.0.3+git161113-5 [12.8 kB]
Get:39 http://172.17.0.1/private buster-staging/main armhf libicu60 armhf 60.2-6 [7789 kB]
Get:40 http://172.17.0.1/private buster-staging/main armhf libxml2 armhf 2.9.4+dfsg1-7 [602 kB]
Get:41 http://172.17.0.1/private buster-staging/main armhf gettext armhf 0.19.8.1-6 [1218 kB]
Get:42 http://172.17.0.1/private buster-staging/main armhf intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:43 http://172.17.0.1/private buster-staging/main armhf po-debconf all 1.0.20 [247 kB]
Get:44 http://172.17.0.1/private buster-staging/main armhf debhelper all 11.3.5 [981 kB]
Get:45 http://172.17.0.1/private buster-staging/main armhf libx11-data all 2:1.6.5-1 [292 kB]
Get:46 http://172.17.0.1/private buster-staging/main armhf libx11-6 armhf 2:1.6.5-1 [683 kB]
Get:47 http://172.17.0.1/private buster-staging/main armhf libxmu6 armhf 2:1.1.2-2 [52.0 kB]
Get:48 http://172.17.0.1/private buster-staging/main armhf libxaw7 armhf 2:1.0.13-1 [164 kB]
Get:49 http://172.17.0.1/private buster-staging/main armhf groff armhf 1.22.3-10 [3091 kB]
Get:50 http://172.17.0.1/private buster-staging/main armhf libmarkdown2 armhf 2.2.3b8-2 [28.7 kB]
Get:51 http://172.17.0.1/private buster-staging/main armhf rubygems-integration all 1.11 [4994 B]
Get:52 http://172.17.0.1/private buster-staging/main armhf ruby2.5 armhf 2.5.1-3 [384 kB]
Get:53 http://172.17.0.1/private buster-staging/main armhf ruby armhf 1:2.5.1 [11.3 kB]
Get:54 http://172.17.0.1/private buster-staging/main armhf rake all 12.3.1-3 [66.9 kB]
Get:55 http://172.17.0.1/private buster-staging/main armhf ruby-did-you-mean all 1.2.1-1 [14.4 kB]
Get:56 http://172.17.0.1/private buster-staging/main armhf ruby-minitest all 5.10.3-1 [53.5 kB]
Get:57 http://172.17.0.1/private buster-staging/main armhf ruby-net-telnet all 0.1.1-2 [12.5 kB]
Get:58 http://172.17.0.1/private buster-staging/main armhf ruby-power-assert all 1.1.1-1 [10.9 kB]
Get:59 http://172.17.0.1/private buster-staging/main armhf ruby-test-unit all 3.2.7-1 [72.3 kB]
Get:60 http://172.17.0.1/private buster-staging/main armhf ruby-xmlrpc all 0.3.0-1 [23.5 kB]
Get:61 http://172.17.0.1/private buster-staging/main armhf libyaml-0-2 armhf 0.2.1-1 [38.8 kB]
Get:62 http://172.17.0.1/private buster-staging/main armhf libruby2.5 armhf 2.5.1-3 [3125 kB]
Get:63 http://172.17.0.1/private buster-staging/main armhf python-markdown all 2.6.9-1 [57.9 kB]
Get:64 http://172.17.0.1/private buster-staging/main armhf ruby-fast-xs armhf 0.8.0-3+b5 [9496 B]
Get:65 http://172.17.0.1/private buster-staging/main armhf ruby-hpricot armhf 0.8.6-6+b2 [84.3 kB]
Get:66 http://172.17.0.1/private buster-staging/main armhf ruby-mustache all 1.0.2-1 [25.1 kB]
Get:67 http://172.17.0.1/private buster-staging/main armhf ruby-rdiscount armhf 2.1.8-1+b2 [34.4 kB]
Get:68 http://172.17.0.1/private buster-staging/main armhf ruby-ronn all 0.7.3-5.1 [23.8 kB]
Get:69 http://172.17.0.1/private buster-staging/main armhf ronn all 0.7.3-5.1 [7920 B]
Get:70 http://172.17.0.1/private buster-staging/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-1 [206 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 32.6 MB in 16s (2003 kB/s)
Selecting previously unselected package libbsd0:armhf.
(Reading database ... 15728 files and directories currently installed.)
Preparing to unpack .../00-libbsd0_0.9.1-1_armhf.deb ...
Unpacking libbsd0:armhf (0.9.1-1) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../01-bsdmainutils_11.1.2_armhf.deb ...
Unpacking bsdmainutils (11.1.2) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../02-groff-base_1.22.3-10_armhf.deb ...
Unpacking groff-base (1.22.3-10) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../03-libpipeline1_1.5.0-1_armhf.deb ...
Unpacking libpipeline1:armhf (1.5.0-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../04-man-db_2.8.3-2_armhf.deb ...
Unpacking man-db (2.8.3-2) ...
Selecting previously unselected package libpython2.7-minimal:armhf.
Preparing to unpack .../05-libpython2.7-minimal_2.7.15-1_armhf.deb ...
Unpacking libpython2.7-minimal:armhf (2.7.15-1) ...
Selecting previously unselected package python2.7-minimal.
Preparing to unpack .../06-python2.7-minimal_2.7.15-1_armhf.deb ...
Unpacking python2.7-minimal (2.7.15-1) ...
Selecting previously unselected package python2-minimal.
Preparing to unpack .../07-python2-minimal_2.7.15-3_armhf.deb ...
Unpacking python2-minimal (2.7.15-3) ...
Selecting previously unselected package python-minimal.
Preparing to unpack .../08-python-minimal_2.7.15-3_armhf.deb ...
Unpacking python-minimal (2.7.15-3) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../09-mime-support_3.61_all.deb ...
Unpacking mime-support (3.61) ...
Selecting previously unselected package libpython2.7-stdlib:armhf.
Preparing to unpack .../10-libpython2.7-stdlib_2.7.15-1_armhf.deb ...
Unpacking libpython2.7-stdlib:armhf (2.7.15-1) ...
Selecting previously unselected package python2.7.
Preparing to unpack .../11-python2.7_2.7.15-1_armhf.deb ...
Unpacking python2.7 (2.7.15-1) ...
Selecting previously unselected package libpython2-stdlib:armhf.
Preparing to unpack .../12-libpython2-stdlib_2.7.15-3_armhf.deb ...
Unpacking libpython2-stdlib:armhf (2.7.15-3) ...
Selecting previously unselected package libpython-stdlib:armhf.
Preparing to unpack .../13-libpython-stdlib_2.7.15-3_armhf.deb ...
Unpacking libpython-stdlib:armhf (2.7.15-3) ...
Setting up libpython2.7-minimal:armhf (2.7.15-1) ...
Setting up python2.7-minimal (2.7.15-1) ...
Setting up python2-minimal (2.7.15-3) ...
Selecting previously unselected package python2.
(Reading database ... 17120 files and directories currently installed.)
Preparing to unpack .../python2_2.7.15-3_armhf.deb ...
Unpacking python2 (2.7.15-3) ...
Setting up python-minimal (2.7.15-3) ...
Selecting previously unselected package python.
(Reading database ... 17153 files and directories currently installed.)
Preparing to unpack .../00-python_2.7.15-3_armhf.deb ...
Unpacking python (2.7.15-3) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../01-libmagic-mgc_1%3a5.33-3_armhf.deb ...
Unpacking libmagic-mgc (1:5.33-3) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../02-libmagic1_1%3a5.33-3_armhf.deb ...
Unpacking libmagic1:armhf (1:5.33-3) ...
Selecting previously unselected package file.
Preparing to unpack .../03-file_1%3a5.33-3_armhf.deb ...
Unpacking file (1:5.33-3) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../04-gettext-base_0.19.8.1-6_armhf.deb ...
Unpacking gettext-base (0.19.8.1-6) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../05-libsigsegv2_2.12-2_armhf.deb ...
Unpacking libsigsegv2:armhf (2.12-2) ...
Selecting previously unselected package m4.
Preparing to unpack .../06-m4_1.4.18-1_armhf.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../07-autoconf_2.69-11_all.deb ...
Unpacking autoconf (2.69-11) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../08-autotools-dev_20180224.1_all.deb ...
Unpacking autotools-dev (20180224.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../09-automake_1%3a1.15.1-3.1_all.deb ...
Unpacking automake (1:1.15.1-3.1) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../10-autopoint_0.19.8.1-6_all.deb ...
Unpacking autopoint (0.19.8.1-6) ...
Selecting previously unselected package libtool.
Preparing to unpack .../11-libtool_2.4.6-2.1_all.deb ...
Unpacking libtool (2.4.6-2.1) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../12-dh-autoreconf_19_all.deb ...
Unpacking dh-autoreconf (19) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../13-libarchive-zip-perl_1.60-1_all.deb ...
Unpacking libarchive-zip-perl (1.60-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../14-libfile-stripnondeterminism-perl_0.042-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (0.042-1) ...
Selecting previously unselected package libtimedate-perl.
Preparing to unpack .../15-libtimedate-perl_2.3000-2_all.deb ...
Unpacking libtimedate-perl (2.3000-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../16-dh-strip-nondeterminism_0.042-1_all.deb ...
Unpacking dh-strip-nondeterminism (0.042-1) ...
Selecting previously unselected package libelf1:armhf.
Preparing to unpack .../17-libelf1_0.170-0.5_armhf.deb ...
Unpacking libelf1:armhf (0.170-0.5) ...
Selecting previously unselected package dwz.
Preparing to unpack .../18-dwz_0.12-2_armhf.deb ...
Unpacking dwz (0.12-2) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../19-libglib2.0-0_2.56.1-2_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.56.1-2) ...
Selecting previously unselected package libfreetype6:armhf.
Preparing to unpack .../20-libfreetype6_2.8.1-2_armhf.deb ...
Unpacking libfreetype6:armhf (2.8.1-2) ...
Selecting previously unselected package libgraphite2-3:armhf.
Preparing to unpack .../21-libgraphite2-3_1.3.11-2_armhf.deb ...
Unpacking libgraphite2-3:armhf (1.3.11-2) ...
Selecting previously unselected package libharfbuzz0b:armhf.
Preparing to unpack .../22-libharfbuzz0b_1.8.2-2_armhf.deb ...
Unpacking libharfbuzz0b:armhf (1.8.2-2) ...
Selecting previously unselected package libicu-le-hb0:armhf.
Preparing to unpack .../23-libicu-le-hb0_1.0.3+git161113-5_armhf.deb ...
Unpacking libicu-le-hb0:armhf (1.0.3+git161113-5) ...
Selecting previously unselected package libicu60:armhf.
Preparing to unpack .../24-libicu60_60.2-6_armhf.deb ...
Unpacking libicu60:armhf (60.2-6) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../25-libxml2_2.9.4+dfsg1-7_armhf.deb ...
Unpacking libxml2:armhf (2.9.4+dfsg1-7) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../26-libcroco3_0.6.12-2_armhf.deb ...
Unpacking libcroco3:armhf (0.6.12-2) ...
Selecting previously unselected package gettext.
Preparing to unpack .../27-gettext_0.19.8.1-6_armhf.deb ...
Unpacking gettext (0.19.8.1-6) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../28-intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../29-po-debconf_1.0.20_all.deb ...
Unpacking po-debconf (1.0.20) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../30-debhelper_11.3.5_all.deb ...
Unpacking debhelper (11.3.5) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../31-x11-common_1%3a7.7+19_all.deb ...
Unpacking x11-common (1:7.7+19) ...
Selecting previously unselected package libice6:armhf.
Preparing to unpack .../32-libice6_2%3a1.0.9-2_armhf.deb ...
Unpacking libice6:armhf (2:1.0.9-2) ...
Selecting previously unselected package libsm6:armhf.
Preparing to unpack .../33-libsm6_2%3a1.2.2-1+b3_armhf.deb ...
Unpacking libsm6:armhf (2:1.2.2-1+b3) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../34-libxau6_1%3a1.0.8-1+b2_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.8-1+b2) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../35-libxdmcp6_1%3a1.1.2-3_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-3) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../36-libxcb1_1.13-1_armhf.deb ...
Unpacking libxcb1:armhf (1.13-1) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../37-libx11-data_2%3a1.6.5-1_all.deb ...
Unpacking libx11-data (2:1.6.5-1) ...
Selecting previously unselected package libx11-6:armhf.
Preparing to unpack .../38-libx11-6_2%3a1.6.5-1_armhf.deb ...
Unpacking libx11-6:armhf (2:1.6.5-1) ...
Selecting previously unselected package libxext6:armhf.
Preparing to unpack .../39-libxext6_2%3a1.3.3-1+b2_armhf.deb ...
Unpacking libxext6:armhf (2:1.3.3-1+b2) ...
Selecting previously unselected package libxt6:armhf.
Preparing to unpack .../40-libxt6_1%3a1.1.5-1_armhf.deb ...
Unpacking libxt6:armhf (1:1.1.5-1) ...
Selecting previously unselected package libxmu6:armhf.
Preparing to unpack .../41-libxmu6_2%3a1.1.2-2_armhf.deb ...
Unpacking libxmu6:armhf (2:1.1.2-2) ...
Selecting previously unselected package libxpm4:armhf.
Preparing to unpack .../42-libxpm4_1%3a3.5.12-1_armhf.deb ...
Unpacking libxpm4:armhf (1:3.5.12-1) ...
Selecting previously unselected package libxaw7:armhf.
Preparing to unpack .../43-libxaw7_2%3a1.0.13-1_armhf.deb ...
Unpacking libxaw7:armhf (2:1.0.13-1) ...
Selecting previously unselected package groff.
Preparing to unpack .../44-groff_1.22.3-10_armhf.deb ...
Unpacking groff (1.22.3-10) ...
Selecting previously unselected package libmarkdown2:armhf.
Preparing to unpack .../45-libmarkdown2_2.2.3b8-2_armhf.deb ...
Unpacking libmarkdown2:armhf (2.2.3b8-2) ...
Selecting previously unselected package rubygems-integration.
Preparing to unpack .../46-rubygems-integration_1.11_all.deb ...
Unpacking rubygems-integration (1.11) ...
Selecting previously unselected package ruby2.5.
Preparing to unpack .../47-ruby2.5_2.5.1-3_armhf.deb ...
Unpacking ruby2.5 (2.5.1-3) ...
Selecting previously unselected package ruby.
Preparing to unpack .../48-ruby_1%3a2.5.1_armhf.deb ...
Unpacking ruby (1:2.5.1) ...
Selecting previously unselected package rake.
Preparing to unpack .../49-rake_12.3.1-3_all.deb ...
Unpacking rake (12.3.1-3) ...
Selecting previously unselected package ruby-did-you-mean.
Preparing to unpack .../50-ruby-did-you-mean_1.2.1-1_all.deb ...
Unpacking ruby-did-you-mean (1.2.1-1) ...
Selecting previously unselected package ruby-minitest.
Preparing to unpack .../51-ruby-minitest_5.10.3-1_all.deb ...
Unpacking ruby-minitest (5.10.3-1) ...
Selecting previously unselected package ruby-net-telnet.
Preparing to unpack .../52-ruby-net-telnet_0.1.1-2_all.deb ...
Unpacking ruby-net-telnet (0.1.1-2) ...
Selecting previously unselected package ruby-power-assert.
Preparing to unpack .../53-ruby-power-assert_1.1.1-1_all.deb ...
Unpacking ruby-power-assert (1.1.1-1) ...
Selecting previously unselected package ruby-test-unit.
Preparing to unpack .../54-ruby-test-unit_3.2.7-1_all.deb ...
Unpacking ruby-test-unit (3.2.7-1) ...
Selecting previously unselected package ruby-xmlrpc.
Preparing to unpack .../55-ruby-xmlrpc_0.3.0-1_all.deb ...
Unpacking ruby-xmlrpc (0.3.0-1) ...
Selecting previously unselected package libyaml-0-2:armhf.
Preparing to unpack .../56-libyaml-0-2_0.2.1-1_armhf.deb ...
Unpacking libyaml-0-2:armhf (0.2.1-1) ...
Selecting previously unselected package libruby2.5:armhf.
Preparing to unpack .../57-libruby2.5_2.5.1-3_armhf.deb ...
Unpacking libruby2.5:armhf (2.5.1-3) ...
Selecting previously unselected package python-markdown.
Preparing to unpack .../58-python-markdown_2.6.9-1_all.deb ...
Unpacking python-markdown (2.6.9-1) ...
Selecting previously unselected package ruby-fast-xs.
Preparing to unpack .../59-ruby-fast-xs_0.8.0-3+b5_armhf.deb ...
Unpacking ruby-fast-xs (0.8.0-3+b5) ...
Selecting previously unselected package ruby-hpricot.
Preparing to unpack .../60-ruby-hpricot_0.8.6-6+b2_armhf.deb ...
Unpacking ruby-hpricot (0.8.6-6+b2) ...
Selecting previously unselected package ruby-mustache.
Preparing to unpack .../61-ruby-mustache_1.0.2-1_all.deb ...
Unpacking ruby-mustache (1.0.2-1) ...
Selecting previously unselected package ruby-rdiscount.
Preparing to unpack .../62-ruby-rdiscount_2.1.8-1+b2_armhf.deb ...
Unpacking ruby-rdiscount (2.1.8-1+b2) ...
Selecting previously unselected package ruby-ronn.
Preparing to unpack .../63-ruby-ronn_0.7.3-5.1_all.deb ...
Unpacking ruby-ronn (0.7.3-5.1) ...
Selecting previously unselected package ronn.
Preparing to unpack .../64-ronn_0.7.3-5.1_all.deb ...
Unpacking ronn (0.7.3-5.1) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../65-zlib1g-dev_1%3a1.2.11.dfsg-1_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-1) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../66-sbuild-build-depends-seqprep-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up ruby-xmlrpc (0.3.0-1) ...
Setting up libarchive-zip-perl (1.60-1) ...
Setting up mime-support (3.61) ...
Installing new version of config file /etc/mime.types ...
Setting up libtimedate-perl (2.3000-2) ...
Setting up libsigsegv2:armhf (2.12-2) ...
Setting up libelf1:armhf (0.170-0.5) ...
Setting up groff-base (1.22.3-10) ...
Setting up libglib2.0-0:armhf (2.56.1-2) ...
No schema files found: removed existing output file.
Setting up gettext-base (0.19.8.1-6) ...
Setting up libpipeline1:armhf (1.5.0-1) ...
Setting up m4 (1.4.18-1) ...
Setting up libbsd0:armhf (0.9.1-1) ...
Setting up libfreetype6:armhf (2.8.1-2) ...
Setting up libmagic-mgc (1:5.33-3) ...
Setting up libmagic1:armhf (1:5.33-3) ...
Setting up libgraphite2-3:armhf (1.3.11-2) ...
Setting up ruby-did-you-mean (1.2.1-1) ...
Setting up libyaml-0-2:armhf (0.2.1-1) ...
Processing triggers for libc-bin (2.27-3+rpi1) ...
Setting up dwz (0.12-2) ...
Setting up autotools-dev (20180224.1) ...
Processing triggers for systemd (238-4) ...
Setting up ruby-net-telnet (0.1.1-2) ...
Setting up rubygems-integration (1.11) ...
Setting up libmarkdown2:armhf (2.2.3b8-2) ...
Setting up libxdmcp6:armhf (1:1.1.2-3) ...
Setting up bsdmainutils (11.1.2) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up ruby-minitest (5.10.3-1) ...
Setting up x11-common (1:7.7+19) ...
update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
Running in chroot, ignoring request.
All runlevel operations denied by policy
invoke-rc.d: policy-rc.d denied execution of restart.
Setting up libx11-data (2:1.6.5-1) ...
Setting up libpython2.7-stdlib:armhf (2.7.15-1) ...
Setting up libxau6:armhf (1:1.0.8-1+b2) ...
Setting up autopoint (0.19.8.1-6) ...
Setting up ruby-power-assert (1.1.1-1) ...
Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-1) ...
Setting up libfile-stripnondeterminism-perl (0.042-1) ...
Setting up ruby-test-unit (3.2.7-1) ...
Setting up python2.7 (2.7.15-1) ...
Setting up libharfbuzz0b:armhf (1.8.2-2) ...
Setting up autoconf (2.69-11) ...
Setting up file (1:5.33-3) ...
Setting up automake (1:1.15.1-3.1) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Setting up libice6:armhf (2:1.0.9-2) ...
Setting up man-db (2.8.3-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libpython2-stdlib:armhf (2.7.15-3) ...
Setting up libxcb1:armhf (1.13-1) ...
Setting up libtool (2.4.6-2.1) ...
Setting up libsm6:armhf (2:1.2.2-1+b3) ...
Setting up libx11-6:armhf (2:1.6.5-1) ...
Setting up python2 (2.7.15-3) ...
Setting up libpython-stdlib:armhf (2.7.15-3) ...
Setting up libxpm4:armhf (1:3.5.12-1) ...
Setting up libxt6:armhf (1:1.1.5-1) ...
Setting up python (2.7.15-3) ...
Setting up python-markdown (2.6.9-1) ...
Setting up libxext6:armhf (2:1.3.3-1+b2) ...
Setting up libxmu6:armhf (2:1.1.2-2) ...
Setting up libxaw7:armhf (2:1.0.13-1) ...
Setting up groff (1.22.3-10) ...
Setting up ruby2.5 (2.5.1-3) ...
Setting up dh-autoreconf (19) ...
Setting up libicu-le-hb0:armhf (1.0.3+git161113-5) ...
Setting up dh-strip-nondeterminism (0.042-1) ...
Setting up ruby (1:2.5.1) ...
Setting up libicu60:armhf (60.2-6) ...
Setting up ruby-mustache (1.0.2-1) ...
Setting up rake (12.3.1-3) ...
Setting up libxml2:armhf (2.9.4+dfsg1-7) ...
Setting up libcroco3:armhf (0.6.12-2) ...
Setting up libruby2.5:armhf (2.5.1-3) ...
Setting up gettext (0.19.8.1-6) ...
Setting up ruby-fast-xs (0.8.0-3+b5) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up ruby-hpricot (0.8.6-6+b2) ...
Setting up ruby-rdiscount (2.1.8-1+b2) ...
Setting up po-debconf (1.0.20) ...
Setting up ruby-ronn (0.7.3-5.1) ...
Setting up debhelper (11.3.5) ...
Setting up ronn (0.7.3-5.1) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.27-3+rpi1) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 4.4.0-124-generic armhf (armv8l)
Toolchain package versions: binutils_2.30-21+rpi1 dpkg-dev_1.19.0.5 g++-7_7.3.0-19 gcc-7_7.3.0-19 libc6-dev_2.27-3+rpi1 libstdc++-7-dev_7.3.0-19 libstdc++6_8.1.0-8+rpi1 linux-libc-dev_4.16.12-1+rpi1
Package versions: adduser_3.117 apt_1.6.1 autoconf_2.69-11 automake_1:1.15.1-3.1 autopoint_0.19.8.1-6 autotools-dev_20180224.1 base-files_10.1+rpi1 base-passwd_3.5.45 bash_4.4.18-3 binutils_2.30-21+rpi1 binutils-arm-linux-gnueabihf_2.30-21+rpi1 binutils-common_2.30-21+rpi1 bsdmainutils_11.1.2 bsdutils_1:2.32-0.1 build-essential_12.5 bzip2_1.0.6-8.1 ca-certificates_20170717 coreutils_8.28-1 cpio_2.12+dfsg-6 cpp_4:7.3.0-3+rpi1 cpp-7_7.3.0-19 dash_0.5.8-2.10 dbus_1.12.8-3 dbus-user-session_1.12.8-3 debconf_1.5.67 debhelper_11.3.5 debianutils_4.8.6 dh-autoreconf_19 dh-strip-nondeterminism_0.042-1 diffutils_1:3.6-1 dirmngr_2.2.8-1 dmsetup_2:1.02.145-4.1+b4 dpkg_1.19.0.5 dpkg-dev_1.19.0.5 dwz_0.12-2 e2fslibs_1.44.2-1 e2fsprogs_1.44.2-1 e2fsprogs-l10n_1.44.2-1 fakeroot_1.22-2 fdisk_2.32-0.1 file_1:5.33-3 findutils_4.6.0+git+20171230-2 g++_4:7.3.0-3+rpi1 g++-7_7.3.0-19 gcc_4:7.3.0-3+rpi1 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-11+rpi1 gcc-4.8-base_4.8.5-4 gcc-4.9-base_4.9.4-2+rpi1+b7 gcc-5-base_5.5.0-8 gcc-7_7.3.0-19 gcc-7-base_7.3.0-19 gcc-8-base_8.1.0-8+rpi1 gettext_0.19.8.1-6 gettext-base_0.19.8.1-6 gnupg_2.2.8-1 gnupg-agent_2.2.8-1 gnupg-l10n_2.2.8-1 gnupg-utils_2.2.8-1 gpg_2.2.8-1 gpg-agent_2.2.8-1 gpg-wks-client_2.2.8-1 gpg-wks-server_2.2.8-1 gpgconf_2.2.8-1 gpgsm_2.2.8-1 gpgv_2.2.8-1 grep_3.1-2 groff_1.22.3-10 groff-base_1.22.3-10 gzip_1.6-5 hostname_3.20 inetutils-ping_2:1.9.4-3 init-system-helpers_1.51 initramfs-tools_0.130 initramfs-tools-core_0.130 intltool-debian_0.35.0+20060710.4 klibc-utils_2.0.4-11+rpi1 kmod_25-1 libacl1_2.2.52-3 libapparmor1_2.12-4 libapt-pkg5.0_1.6.1 libarchive-zip-perl_1.60-1 libargon2-0_0~20161029-2 libasan4_7.3.0-19 libassuan0_2.5.1-2 libatomic1_8.1.0-8+rpi1 libattr1_1:2.4.47-2 libaudit-common_1:2.8.3-1 libaudit1_1:2.8.3-1 libbinutils_2.30-21+rpi1 libblkid1_2.32-0.1 libbsd0_0.9.1-1 libbz2-1.0_1.0.6-8.1 libc-bin_2.27-3+rpi1 libc-dev-bin_2.27-3+rpi1 libc6_2.27-3+rpi1 libc6-dev_2.27-3+rpi1 libcap-ng0_0.7.9-1 libcap2_1:2.25-1.2 libcc1-0_8.1.0-8+rpi1 libcilkrts5_7.3.0-19 libcom-err2_1.44.2-1 libcroco3_0.6.12-2 libcryptsetup12_2:2.0.2-1 libcryptsetup4_2:1.7.5-1 libdb5.3_5.3.28-13.1 libdbus-1-3_1.12.8-3 libdebconfclient0_0.243 libdevmapper1.02.1_2:1.02.145-4.1+b4 libdpkg-perl_1.19.0.5 libdrm-common_2.4.92-1+rpi1 libdrm2_2.4.92-1+rpi1 libelf1_0.170-0.5 libexpat1_2.2.5-3 libext2fs2_1.44.2-1 libfakeroot_1.22-2 libfdisk1_2.32-0.1 libffi6_3.2.1-8 libfile-stripnondeterminism-perl_0.042-1 libfreetype6_2.8.1-2 libgcc-7-dev_7.3.0-19 libgcc1_1:8.1.0-8+rpi1 libgcrypt20_1.8.3-1 libgdbm-compat4_1.14.1-6 libgdbm3_1.8.3-14 libgdbm5_1.14.1-6 libglib2.0-0_2.56.1-2 libgmp10_2:6.1.2+dfsg-3 libgnutls30_3.5.18-1 libgomp1_8.1.0-8+rpi1 libgpg-error0_1.31-1 libgraphite2-3_1.3.11-2 libharfbuzz0b_1.8.2-2 libhogweed4_3.4-1 libice6_2:1.0.9-2 libicu-le-hb0_1.0.3+git161113-5 libicu60_60.2-6 libidn11_1.33-2.2 libidn2-0_2.0.4-1.1 libip4tc0_1.6.2-1 libisl19_0.19-1 libjson-c3_0.12.1-1.3 libklibc_2.0.4-11+rpi1 libkmod2_25-1 libksba8_1.3.5-2 libldap-2.4-2_2.4.46+dfsg-5+rpi1 libldap-common_2.4.46+dfsg-5+rpi1 liblz4-1_1.8.2-1+rpi1 liblzma5_5.2.2-1.3 libmagic-mgc_1:5.33-3 libmagic1_1:5.33-3 libmarkdown2_2.2.3b8-2 libmount1_2.32-0.1 libmpc3_1.1.0-1 libmpfr6_4.0.1-1 libncurses5_6.1+20180210-4 libncurses6_6.1+20180210-4 libncursesw5_6.1+20180210-4 libncursesw6_6.1+20180210-4 libnettle6_3.4-1 libnpth0_1.5-4 libnss-systemd_238-4 libp11-kit0_0.23.12-2 libpam-modules_1.1.8-3.7 libpam-modules-bin_1.1.8-3.7 libpam-runtime_1.1.8-3.7 libpam-systemd_238-4 libpam0g_1.1.8-3.7 libpcre3_2:8.39-9 libperl5.24_5.24.1-7 libperl5.26_5.26.2-6 libpipeline1_1.5.0-1 libplymouth4_0.9.3-3 libpng16-16_1.6.34-1 libprocps7_2:3.3.15-2 libpython-stdlib_2.7.15-3 libpython2-stdlib_2.7.15-3 libpython2.7-minimal_2.7.15-1 libpython2.7-stdlib_2.7.15-1 libreadline7_7.0-5 libruby2.5_2.5.1-3 libsasl2-2_2.1.27~101-g0780600+dfsg-3.1 libsasl2-modules_2.1.27~101-g0780600+dfsg-3.1 libsasl2-modules-db_2.1.27~101-g0780600+dfsg-3.1 libseccomp2_2.3.3-2 libselinux1_2.8-1 libsemanage-common_2.8-1 libsemanage1_2.8-1 libsepol1_2.8-1 libsigsegv2_2.12-2 libsm6_2:1.2.2-1+b3 libsmartcols1_2.32-0.1 libsqlite3-0_3.24.0-1 libss2_1.44.2-1 libssl1.1_1.1.0h-4 libstdc++-7-dev_7.3.0-19 libstdc++6_8.1.0-8+rpi1 libsystemd0_238-4 libtasn1-6_4.13-3 libtimedate-perl_2.3000-2 libtinfo5_6.1+20180210-4 libtinfo6_6.1+20180210-4 libtool_2.4.6-2.1 libubsan0_7.3.0-19 libudev1_238-4 libunistring2_0.9.8-1 libustr-1.0-1_1.0.4-6 libuuid1_2.32-0.1 libx11-6_2:1.6.5-1 libx11-data_2:1.6.5-1 libxau6_1:1.0.8-1+b2 libxaw7_2:1.0.13-1 libxcb1_1.13-1 libxdmcp6_1:1.1.2-3 libxext6_2:1.3.3-1+b2 libxml2_2.9.4+dfsg1-7 libxmu6_2:1.1.2-2 libxpm4_1:3.5.12-1 libxt6_1:1.1.5-1 libyaml-0-2_0.2.1-1 libzstd1_1.3.4+dfsg-3+rpi1 linux-base_4.5 linux-libc-dev_4.16.12-1+rpi1 login_1:4.5-1 lsb-base_9.20170808+rpi1 m4_1.4.18-1 make_4.1-9.1 makedev_2.3.1-93 man-db_2.8.3-2 mawk_1.3.3-17 mime-support_3.61 mount_2.32-0.1 multiarch-support_2.27-3+rpi1 nano_2.9.8-1 ncurses-base_6.1+20180210-4 ncurses-bin_6.1+20180210-4 netbase_5.4 openssl_1.1.0h-4 passwd_1:4.5-1 patch_2.7.6-2 perl_5.26.2-6 perl-base_5.26.2-6 perl-modules-5.24_5.24.1-7 perl-modules-5.26_5.26.2-6 pinentry-curses_1.1.0-1 plymouth_0.9.3-3 po-debconf_1.0.20 procps_2:3.3.15-2 python_2.7.15-3 python-markdown_2.6.9-1 python-minimal_2.7.15-3 python2_2.7.15-3 python2-minimal_2.7.15-3 python2.7_2.7.15-1 python2.7-minimal_2.7.15-1 rake_12.3.1-3 raspbian-archive-keyring_20120528.2 readline-common_7.0-5 ronn_0.7.3-5.1 ruby_1:2.5.1 ruby-did-you-mean_1.2.1-1 ruby-fast-xs_0.8.0-3+b5 ruby-hpricot_0.8.6-6+b2 ruby-minitest_5.10.3-1 ruby-mustache_1.0.2-1 ruby-net-telnet_0.1.1-2 ruby-power-assert_1.1.1-1 ruby-rdiscount_2.1.8-1+b2 ruby-ronn_0.7.3-5.1 ruby-test-unit_3.2.7-1 ruby-xmlrpc_0.3.0-1 ruby2.5_2.5.1-3 rubygems-integration_1.11 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.4-2 sensible-utils_0.0.12 systemd_238-4 systemd-sysv_238-4 sysvinit-utils_2.88dsf-59.10 tar_1.30+dfsg-2 tzdata_2018e-1 udev_238-4 util-linux_2.32-0.1 x11-common_1:7.7+19 xz-utils_5.2.2-1.3 zlib1g_1:1.2.11.dfsg-1 zlib1g-dev_1:1.2.11.dfsg-1
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/sbuild-nonexistent/.gnupg/trustedkeys.kbx': General error
gpgv: Signature made Mon Jul 9 07:34:12 2018 UTC
gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv: issuer "tille@debian.org"
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-3.dsc
dpkg-source: info: extracting seqprep in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.3.2-3.debian.tar.xz
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
Check disk space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=buster-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=buster-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=112
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=buster-staging-armhf-sbuild-fb504a14-b640-472f-880b-d209ac6f31c9
SCHROOT_UID=107
SCHROOT_USER=buildd
SHELL=/bin/sh
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: info: source package seqprep
dpkg-buildpackage: info: source version 1.3.2-3
dpkg-buildpackage: info: source distribution unstable
dpkg-source --before-build seqprep-1.3.2
dpkg-buildpackage: info: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_auto_clean
make -j4 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
rm -f SeqPrep.o utils.o stdaln.o SeqPrep
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean
rm -f seqprep
rm -f debian/*.1
rm -f README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules build-arch
dh build-arch
dh_update_autotools_config -a
dh_autoreconf -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build
make -j4 "INSTALL=install --strip-program=true"
make[2]: Entering directory '/<<PKGBUILDDIR>>'
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o
SeqPrep.c: In function 'main':
SeqPrep.c:166:15: warning: implicit declaration of function 'getopt'; did you mean 'getgid'? [-Wimplicit-function-declaration]
while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) {
^~~~~~
getgid
cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
cp SeqPrep seqprep
TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn
roff: debian/seqprep.1
markdown_py -f README.html README.md
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 0.495245
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 0.461994
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
create-stamp debian/debhelper-build-stamp
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j4 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true"
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
Makefile:15: recipe for target 'install' failed
make[1]: [install] Error 1 (ignored)
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_strip_nondeterminism -a
dh_compress -a
dh_fixperms -a
dh_missing -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dpkg-shlibdeps: warning: package could avoid a useless dependency if debian/seqprep/usr/bin/seqprep was not linked against ld-linux-armhf.so.3 (it uses none of the library's symbols)
dh_installdeb -a
dh_gencontrol -a
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-3_armhf.deb'.
dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-3_armhf.deb'.
dpkg-genbuildinfo --build=any
dpkg-genchanges --build=any -mRaspbian mythic lxc autobuilder 1 <root@raspbian.org> >../seqprep_1.3.2-3_armhf.changes
dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build seqprep-1.3.2
dpkg-buildpackage: info: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 2018-07-11T06:03:47Z
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
seqprep_1.3.2-3_armhf.changes:
------------------------------
Format: 1.8
Date: Fri, 06 Jul 2018 15:26:19 +0200
Source: seqprep
Binary: seqprep seqprep-data
Architecture: armhf
Version: 1.3.2-3
Distribution: buster-staging
Urgency: medium
Maintainer: Raspbian mythic lxc autobuilder 1 <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
seqprep-data - example data set for seqprep - only used for testing
Closes: 903071
Changes:
seqprep (1.3.2-3) unstable; urgency=medium
.
* Build-Depends: ruby-ronn -> ronn
Closes: #903071
* debhelper 11
* Point Vcs fields to salsa.debian.org
* Standards-Version: 4.1.4
Checksums-Sha1:
2a6fc2889de978f78555e0358d2a2915d7954ea1 16332 seqprep-dbgsym_1.3.2-3_armhf.deb
0cba3019c0e95a8b2aa59a27e87ffde4c3bcd334 6082 seqprep_1.3.2-3_armhf.buildinfo
9ecdbca2a18cbe06b1a23e98750873c0dc98103a 27036 seqprep_1.3.2-3_armhf.deb
Checksums-Sha256:
c84130cbeaf4d8e82a9d9098a3cd71814dbdc2c3ed8bde9dbbd3e622242a510c 16332 seqprep-dbgsym_1.3.2-3_armhf.deb
6230a5b063a47634f874b2c25ab085a78100282daeef465da20f72532c76d4b3 6082 seqprep_1.3.2-3_armhf.buildinfo
f6bb03c6551b9bd614818fb1dbb5f6da27f8d92d51aa19ae879ec7fb948bb02e 27036 seqprep_1.3.2-3_armhf.deb
Files:
7ea3d9baf048f54b9af11484bdf4b121 16332 debug optional seqprep-dbgsym_1.3.2-3_armhf.deb
e293144052ff9e70c8984d77550ff547 6082 science optional seqprep_1.3.2-3_armhf.buildinfo
d0b7969d6fbfbdaedac69db2eb1ad856 27036 science optional seqprep_1.3.2-3_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
seqprep-dbgsym_1.3.2-3_armhf.deb
--------------------------------
new Debian package, version 2.0.
size 16332 bytes: control archive=536 bytes.
369 bytes, 12 lines control
106 bytes, 1 lines md5sums
Package: seqprep-dbgsym
Source: seqprep
Version: 1.3.2-3
Auto-Built-Package: debug-symbols
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 32
Depends: seqprep (= 1.3.2-3)
Section: debug
Priority: optional
Description: debug symbols for seqprep
Build-Ids: b66ea7515644f0b6e3f295bfff92572a395f489f
drwxr-xr-x root/root 0 2018-07-06 13:26 ./
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/lib/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/lib/debug/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/lib/debug/.build-id/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/lib/debug/.build-id/b6/
-rw-r--r-- root/root 21552 2018-07-06 13:26 ./usr/lib/debug/.build-id/b6/6ea7515644f0b6e3f295bfff92572a395f489f.debug
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/doc/
lrwxrwxrwx root/root 0 2018-07-06 13:26 ./usr/share/doc/seqprep-dbgsym -> seqprep
seqprep_1.3.2-3_armhf.deb
-------------------------
new Debian package, version 2.0.
size 27036 bytes: control archive=1104 bytes.
1172 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.3.2-3
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 122
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2018-07-06 13:26 ./
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/bin/
-rwxr-xr-x root/root 94704 2018-07-06 13:26 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/doc/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11749 2018-07-06 13:26 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 1019 2018-07-06 13:26 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1439 2018-07-06 13:26 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/man/
drwxr-xr-x root/root 0 2018-07-06 13:26 ./usr/share/man/man1/
-rw-r--r-- root/root 4566 2018-07-06 13:26 ./usr/share/man/man1/seqprep.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 65200
Build-Time: 69
Distribution: buster-staging
Host Architecture: armhf
Install-Time: 296
Job: seqprep_1.3.2-3
Machine Architecture: armhf
Package: seqprep
Package-Time: 393
Source-Version: 1.3.2-3
Space: 65200
Status: successful
Version: 1.3.2-3
--------------------------------------------------------------------------------
Finished at 2018-07-11T06:03:47Z
Build needed 00:06:33, 65200k disk space