seqprep →
1.3.2-2 →
armhf → 2017-11-23 05:54:06
sbuild (Debian sbuild) 0.71.0 (24 Aug 2016) on bm-wb-04
+==============================================================================+
| seqprep 1.3.2-2 (armhf) Thu, 23 Nov 2017 05:38:56 +0000 |
+==============================================================================+
Package: seqprep
Version: 1.3.2-2
Source Version: 1.3.2-2
Distribution: buster-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/buster-staging-armhf-sbuild-05bb5c2f-4b37-45dd-8f5a-92ab587e9be0' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private buster-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private buster-staging/main Sources [10.4 MB]
Get:3 http://172.17.0.1/private buster-staging/main armhf Packages [12.2 MB]
Fetched 22.6 MB in 26s (849 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at:
https://anonscm.debian.org/git/debian-med/seqprep.git
Please use:
git clone https://anonscm.debian.org/git/debian-med/seqprep.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-2 (dsc) [2132 B]
Get:2 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-2 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private buster-staging/main seqprep 1.3.2-2 (diff) [9240 B]
Fetched 37.2 MB in 4s (8461 kB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/seqprep-FQ7mTX/seqprep-1.3.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/seqprep-FQ7mTX' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install build-essential |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-0OrKiu/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-0OrKiu/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-0OrKiu/gpg/trustdb.gpg: trustdb created
gpg: key 35506D9A48F77B2E: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg: imported: 1
gpg: key 35506D9A48F77B2E: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 35506D9A48F77B2E: secret key imported
gpg: Total number processed: 1
gpg: unchanged: 1
gpg: secret keys read: 1
gpg: secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Packages [433 B]
Fetched 2109 B in 0s (2824 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install core build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 6 not upgraded.
Need to get 852 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [852 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 852 B in 0s (20.8 kB/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 13068 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (armhf included in any all)
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper (>= 10), python, python-markdown, ruby-ronn, zlib1g-dev
Filtered Build-Depends: debhelper (>= 10), python, python-markdown, ruby-ronn, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<<BUILDDIR>>/resolver-0OrKiu/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy sbuild-build-depends-seqprep-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Sources [519 B]
Get:5 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ Packages [601 B]
Fetched 2453 B in 0s (3336 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install seqprep build dependencies (apt-based resolver)
-------------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libice6 libicu57
libmagic-mgc libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libssl1.0.2 libssl1.1 libtimedate-perl libtool libx11-6 libx11-data libxau6
libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6
libyaml-0-2 m4 man-db mime-support openssl po-debconf python python-markdown
python-minimal python2.7 python2.7-minimal rake ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.3
rubygems-integration x11-common zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
vacation dh-make dwz gettext-doc libasprintf-dev libgettextpo-dev
libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc less www-browser
libmail-box-perl python-doc python-tk python-markdown-doc python2.7-doc
binfmt-support ri ruby-dev bundler
Recommended packages:
curl | wget | lynx-cur ghostscript imagemagick libpaper1 netpbm psutils
libarchive-cpio-perl libglib2.0-data shared-mime-info xdg-user-dirs
libltdl-dev libmail-sendmail-perl python-pygments python-yaml zip fonts-lato
libjs-jquery
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libfile-stripnondeterminism-perl libglib2.0-0 libice6 libicu57
libmagic-mgc libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libssl1.0.2 libssl1.1 libtimedate-perl libtool libx11-6 libx11-data libxau6
libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6
libyaml-0-2 m4 man-db mime-support openssl po-debconf python python-markdown
python-minimal python2.7 python2.7-minimal rake ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.3
rubygems-integration sbuild-build-depends-seqprep-dummy x11-common
zlib1g-dev
0 upgraded, 76 newly installed, 0 to remove and 6 not upgraded.
Need to get 34.2 MB of archives.
After this operation, 116 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-0OrKiu/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [888 B]
Get:2 http://172.17.0.1/private buster-staging/main armhf groff-base armhf 1.22.3-9 [1005 kB]
Get:3 http://172.17.0.1/private buster-staging/main armhf libbsd0 armhf 0.8.6-3 [95.9 kB]
Get:4 http://172.17.0.1/private buster-staging/main armhf bsdmainutils armhf 9.0.14 [178 kB]
Get:5 http://172.17.0.1/private buster-staging/main armhf libpipeline1 armhf 1.5.0-1 [24.6 kB]
Get:6 http://172.17.0.1/private buster-staging/main armhf man-db armhf 2.7.6.1-2 [1014 kB]
Get:7 http://172.17.0.1/private buster-staging/main armhf libpython2.7-minimal armhf 2.7.14-2 [393 kB]
Get:8 http://172.17.0.1/private buster-staging/main armhf python2.7-minimal armhf 2.7.14-2 [1091 kB]
Get:9 http://172.17.0.1/private buster-staging/main armhf python-minimal armhf 2.7.14-1 [40.7 kB]
Get:10 http://172.17.0.1/private buster-staging/main armhf mime-support all 3.60 [36.7 kB]
Get:11 http://172.17.0.1/private buster-staging/main armhf libexpat1 armhf 2.2.3-2 [73.6 kB]
Get:12 http://172.17.0.1/private buster-staging/main armhf libssl1.1 armhf 1.1.0g-2 [1100 kB]
Get:13 http://172.17.0.1/private buster-staging/main armhf libpython2.7-stdlib armhf 2.7.14-2 [1854 kB]
Get:14 http://172.17.0.1/private buster-staging/main armhf python2.7 armhf 2.7.14-2 [292 kB]
Get:15 http://172.17.0.1/private buster-staging/main armhf libpython-stdlib armhf 2.7.14-1 [20.1 kB]
Get:16 http://172.17.0.1/private buster-staging/main armhf python armhf 2.7.14-1 [155 kB]
Get:17 http://172.17.0.1/private buster-staging/main armhf libssl1.0.2 armhf 1.0.2m-3 [887 kB]
Get:18 http://172.17.0.1/private buster-staging/main armhf libmagic-mgc armhf 1:5.32-1 [225 kB]
Get:19 http://172.17.0.1/private buster-staging/main armhf libmagic1 armhf 1:5.32-1 [105 kB]
Get:20 http://172.17.0.1/private buster-staging/main armhf file armhf 1:5.32-1 [63.7 kB]
Get:21 http://172.17.0.1/private buster-staging/main armhf gettext-base armhf 0.19.8.1-4 [117 kB]
Get:22 http://172.17.0.1/private buster-staging/main armhf libicu57 armhf 57.1-8 [7411 kB]
Get:23 http://172.17.0.1/private buster-staging/main armhf libxml2 armhf 2.9.4+dfsg1-5 [609 kB]
Get:24 http://172.17.0.1/private buster-staging/main armhf libsigsegv2 armhf 2.11-1 [29.3 kB]
Get:25 http://172.17.0.1/private buster-staging/main armhf m4 armhf 1.4.18-1 [185 kB]
Get:26 http://172.17.0.1/private buster-staging/main armhf autoconf all 2.69-11 [341 kB]
Get:27 http://172.17.0.1/private buster-staging/main armhf autotools-dev all 20161112.1+nmu1 [74.2 kB]
Get:28 http://172.17.0.1/private buster-staging/main armhf automake all 1:1.15.1-3 [736 kB]
Get:29 http://172.17.0.1/private buster-staging/main armhf autopoint all 0.19.8.1-4 [434 kB]
Get:30 http://172.17.0.1/private buster-staging/main armhf openssl armhf 1.1.0g-2 [707 kB]
Get:31 http://172.17.0.1/private buster-staging/main armhf ca-certificates all 20170717 [178 kB]
Get:32 http://172.17.0.1/private buster-staging/main armhf libtool all 2.4.6-2 [545 kB]
Get:33 http://172.17.0.1/private buster-staging/main armhf dh-autoreconf all 15 [16.2 kB]
Get:34 http://172.17.0.1/private buster-staging/main armhf libarchive-zip-perl all 1.59-1 [95.5 kB]
Get:35 http://172.17.0.1/private buster-staging/main armhf libfile-stripnondeterminism-perl all 0.040-1 [18.4 kB]
Get:36 http://172.17.0.1/private buster-staging/main armhf libtimedate-perl all 2.3000-2 [42.2 kB]
Get:37 http://172.17.0.1/private buster-staging/main armhf dh-strip-nondeterminism all 0.040-1 [11.8 kB]
Get:38 http://172.17.0.1/private buster-staging/main armhf libglib2.0-0 armhf 2.54.1-1 [2653 kB]
Get:39 http://172.17.0.1/private buster-staging/main armhf libcroco3 armhf 0.6.12-1 [132 kB]
Get:40 http://172.17.0.1/private buster-staging/main armhf gettext armhf 0.19.8.1-4 [1218 kB]
Get:41 http://172.17.0.1/private buster-staging/main armhf intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:42 http://172.17.0.1/private buster-staging/main armhf po-debconf all 1.0.20 [247 kB]
Get:43 http://172.17.0.1/private buster-staging/main armhf debhelper all 10.10.5 [978 kB]
Get:44 http://172.17.0.1/private buster-staging/main armhf x11-common all 1:7.7+19 [251 kB]
Get:45 http://172.17.0.1/private buster-staging/main armhf libice6 armhf 2:1.0.9-2 [51.6 kB]
Get:46 http://172.17.0.1/private buster-staging/main armhf libsm6 armhf 2:1.2.2-1+b3 [31.2 kB]
Get:47 http://172.17.0.1/private buster-staging/main armhf libxau6 armhf 1:1.0.8-1+b2 [19.1 kB]
Get:48 http://172.17.0.1/private buster-staging/main armhf libxdmcp6 armhf 1:1.1.2-3 [25.0 kB]
Get:49 http://172.17.0.1/private buster-staging/main armhf libxcb1 armhf 1.12-1 [129 kB]
Get:50 http://172.17.0.1/private buster-staging/main armhf libx11-data all 2:1.6.4-3 [290 kB]
Get:51 http://172.17.0.1/private buster-staging/main armhf libx11-6 armhf 2:1.6.4-3 [683 kB]
Get:52 http://172.17.0.1/private buster-staging/main armhf libxext6 armhf 2:1.3.3-1+b2 [47.8 kB]
Get:53 http://172.17.0.1/private buster-staging/main armhf libxt6 armhf 1:1.1.5-1 [155 kB]
Get:54 http://172.17.0.1/private buster-staging/main armhf libxmu6 armhf 2:1.1.2-2 [52.0 kB]
Get:55 http://172.17.0.1/private buster-staging/main armhf libxpm4 armhf 1:3.5.12-1 [43.6 kB]
Get:56 http://172.17.0.1/private buster-staging/main armhf libxaw7 armhf 2:1.0.13-1 [164 kB]
Get:57 http://172.17.0.1/private buster-staging/main armhf groff armhf 1.22.3-9 [3072 kB]
Get:58 http://172.17.0.1/private buster-staging/main armhf libmarkdown2 armhf 2.2.3b8-2 [28.7 kB]
Get:59 http://172.17.0.1/private buster-staging/main armhf rubygems-integration all 1.11 [4994 B]
Get:60 http://172.17.0.1/private buster-staging/main armhf ruby2.3 armhf 2.3.3-1+deb9u1+rpi1 [187 kB]
Get:61 http://172.17.0.1/private buster-staging/main armhf ruby armhf 1:2.3.3 [10.8 kB]
Get:62 http://172.17.0.1/private buster-staging/main armhf rake all 12.0.0-1 [45.7 kB]
Get:63 http://172.17.0.1/private buster-staging/main armhf ruby-did-you-mean all 1.0.0-2 [11.2 kB]
Get:64 http://172.17.0.1/private buster-staging/main armhf ruby-minitest all 5.10.3-1 [53.5 kB]
Get:65 http://172.17.0.1/private buster-staging/main armhf ruby-net-telnet all 0.1.1-2 [12.5 kB]
Get:66 http://172.17.0.1/private buster-staging/main armhf ruby-power-assert all 0.3.0-1 [7902 B]
Get:67 http://172.17.0.1/private buster-staging/main armhf ruby-test-unit all 3.2.5-1 [71.7 kB]
Get:68 http://172.17.0.1/private buster-staging/main armhf libyaml-0-2 armhf 0.1.7-2 [39.9 kB]
Get:69 http://172.17.0.1/private buster-staging/main armhf libruby2.3 armhf 2.3.3-1+deb9u1+rpi1 [2865 kB]
Get:70 http://172.17.0.1/private buster-staging/main armhf python-markdown all 2.6.9-1 [57.9 kB]
Get:71 http://172.17.0.1/private buster-staging/main armhf ruby-fast-xs armhf 0.8.0-3+b4 [8562 B]
Get:72 http://172.17.0.1/private buster-staging/main armhf ruby-hpricot armhf 0.8.6-6+b1 [66.0 kB]
Get:73 http://172.17.0.1/private buster-staging/main armhf ruby-mustache all 1.0.2-1 [25.1 kB]
Get:74 http://172.17.0.1/private buster-staging/main armhf ruby-rdiscount armhf 2.1.8-1+b1 [32.9 kB]
Get:75 http://172.17.0.1/private buster-staging/main armhf ruby-ronn all 0.7.3-5 [29.8 kB]
Get:76 http://172.17.0.1/private buster-staging/main armhf zlib1g-dev armhf 1:1.2.8.dfsg-5 [198 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 34.2 MB in 6s (5215 kB/s)
Selecting previously unselected package groff-base.
(Reading database ... 13068 files and directories currently installed.)
Preparing to unpack .../00-groff-base_1.22.3-9_armhf.deb ...
Unpacking groff-base (1.22.3-9) ...
Selecting previously unselected package libbsd0:armhf.
Preparing to unpack .../01-libbsd0_0.8.6-3_armhf.deb ...
Unpacking libbsd0:armhf (0.8.6-3) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../02-bsdmainutils_9.0.14_armhf.deb ...
Unpacking bsdmainutils (9.0.14) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../03-libpipeline1_1.5.0-1_armhf.deb ...
Unpacking libpipeline1:armhf (1.5.0-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../04-man-db_2.7.6.1-2_armhf.deb ...
Unpacking man-db (2.7.6.1-2) ...
Selecting previously unselected package libpython2.7-minimal:armhf.
Preparing to unpack .../05-libpython2.7-minimal_2.7.14-2_armhf.deb ...
Unpacking libpython2.7-minimal:armhf (2.7.14-2) ...
Selecting previously unselected package python2.7-minimal.
Preparing to unpack .../06-python2.7-minimal_2.7.14-2_armhf.deb ...
Unpacking python2.7-minimal (2.7.14-2) ...
Selecting previously unselected package python-minimal.
Preparing to unpack .../07-python-minimal_2.7.14-1_armhf.deb ...
Unpacking python-minimal (2.7.14-1) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../08-mime-support_3.60_all.deb ...
Unpacking mime-support (3.60) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../09-libexpat1_2.2.3-2_armhf.deb ...
Unpacking libexpat1:armhf (2.2.3-2) ...
Selecting previously unselected package libssl1.1:armhf.
Preparing to unpack .../10-libssl1.1_1.1.0g-2_armhf.deb ...
Unpacking libssl1.1:armhf (1.1.0g-2) ...
Selecting previously unselected package libpython2.7-stdlib:armhf.
Preparing to unpack .../11-libpython2.7-stdlib_2.7.14-2_armhf.deb ...
Unpacking libpython2.7-stdlib:armhf (2.7.14-2) ...
Selecting previously unselected package python2.7.
Preparing to unpack .../12-python2.7_2.7.14-2_armhf.deb ...
Unpacking python2.7 (2.7.14-2) ...
Selecting previously unselected package libpython-stdlib:armhf.
Preparing to unpack .../13-libpython-stdlib_2.7.14-1_armhf.deb ...
Unpacking libpython-stdlib:armhf (2.7.14-1) ...
Setting up libpython2.7-minimal:armhf (2.7.14-2) ...
Setting up python2.7-minimal (2.7.14-2) ...
Setting up python-minimal (2.7.14-1) ...
Selecting previously unselected package python.
(Reading database ... 14429 files and directories currently installed.)
Preparing to unpack .../00-python_2.7.14-1_armhf.deb ...
Unpacking python (2.7.14-1) ...
Selecting previously unselected package libssl1.0.2:armhf.
Preparing to unpack .../01-libssl1.0.2_1.0.2m-3_armhf.deb ...
Unpacking libssl1.0.2:armhf (1.0.2m-3) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../02-libmagic-mgc_1%3a5.32-1_armhf.deb ...
Unpacking libmagic-mgc (1:5.32-1) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../03-libmagic1_1%3a5.32-1_armhf.deb ...
Unpacking libmagic1:armhf (1:5.32-1) ...
Selecting previously unselected package file.
Preparing to unpack .../04-file_1%3a5.32-1_armhf.deb ...
Unpacking file (1:5.32-1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../05-gettext-base_0.19.8.1-4_armhf.deb ...
Unpacking gettext-base (0.19.8.1-4) ...
Selecting previously unselected package libicu57:armhf.
Preparing to unpack .../06-libicu57_57.1-8_armhf.deb ...
Unpacking libicu57:armhf (57.1-8) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../07-libxml2_2.9.4+dfsg1-5_armhf.deb ...
Unpacking libxml2:armhf (2.9.4+dfsg1-5) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../08-libsigsegv2_2.11-1_armhf.deb ...
Unpacking libsigsegv2:armhf (2.11-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../09-m4_1.4.18-1_armhf.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../10-autoconf_2.69-11_all.deb ...
Unpacking autoconf (2.69-11) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../11-autotools-dev_20161112.1+nmu1_all.deb ...
Unpacking autotools-dev (20161112.1+nmu1) ...
Selecting previously unselected package automake.
Preparing to unpack .../12-automake_1%3a1.15.1-3_all.deb ...
Unpacking automake (1:1.15.1-3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../13-autopoint_0.19.8.1-4_all.deb ...
Unpacking autopoint (0.19.8.1-4) ...
Selecting previously unselected package openssl.
Preparing to unpack .../14-openssl_1.1.0g-2_armhf.deb ...
Unpacking openssl (1.1.0g-2) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../15-ca-certificates_20170717_all.deb ...
Unpacking ca-certificates (20170717) ...
Selecting previously unselected package libtool.
Preparing to unpack .../16-libtool_2.4.6-2_all.deb ...
Unpacking libtool (2.4.6-2) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../17-dh-autoreconf_15_all.deb ...
Unpacking dh-autoreconf (15) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../18-libarchive-zip-perl_1.59-1_all.deb ...
Unpacking libarchive-zip-perl (1.59-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../19-libfile-stripnondeterminism-perl_0.040-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (0.040-1) ...
Selecting previously unselected package libtimedate-perl.
Preparing to unpack .../20-libtimedate-perl_2.3000-2_all.deb ...
Unpacking libtimedate-perl (2.3000-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../21-dh-strip-nondeterminism_0.040-1_all.deb ...
Unpacking dh-strip-nondeterminism (0.040-1) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../22-libglib2.0-0_2.54.1-1_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.54.1-1) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../23-libcroco3_0.6.12-1_armhf.deb ...
Unpacking libcroco3:armhf (0.6.12-1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../24-gettext_0.19.8.1-4_armhf.deb ...
Unpacking gettext (0.19.8.1-4) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../25-intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../26-po-debconf_1.0.20_all.deb ...
Unpacking po-debconf (1.0.20) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../27-debhelper_10.10.5_all.deb ...
Unpacking debhelper (10.10.5) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../28-x11-common_1%3a7.7+19_all.deb ...
Unpacking x11-common (1:7.7+19) ...
Selecting previously unselected package libice6:armhf.
Preparing to unpack .../29-libice6_2%3a1.0.9-2_armhf.deb ...
Unpacking libice6:armhf (2:1.0.9-2) ...
Selecting previously unselected package libsm6:armhf.
Preparing to unpack .../30-libsm6_2%3a1.2.2-1+b3_armhf.deb ...
Unpacking libsm6:armhf (2:1.2.2-1+b3) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../31-libxau6_1%3a1.0.8-1+b2_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.8-1+b2) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../32-libxdmcp6_1%3a1.1.2-3_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-3) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../33-libxcb1_1.12-1_armhf.deb ...
Unpacking libxcb1:armhf (1.12-1) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../34-libx11-data_2%3a1.6.4-3_all.deb ...
Unpacking libx11-data (2:1.6.4-3) ...
Selecting previously unselected package libx11-6:armhf.
Preparing to unpack .../35-libx11-6_2%3a1.6.4-3_armhf.deb ...
Unpacking libx11-6:armhf (2:1.6.4-3) ...
Selecting previously unselected package libxext6:armhf.
Preparing to unpack .../36-libxext6_2%3a1.3.3-1+b2_armhf.deb ...
Unpacking libxext6:armhf (2:1.3.3-1+b2) ...
Selecting previously unselected package libxt6:armhf.
Preparing to unpack .../37-libxt6_1%3a1.1.5-1_armhf.deb ...
Unpacking libxt6:armhf (1:1.1.5-1) ...
Selecting previously unselected package libxmu6:armhf.
Preparing to unpack .../38-libxmu6_2%3a1.1.2-2_armhf.deb ...
Unpacking libxmu6:armhf (2:1.1.2-2) ...
Selecting previously unselected package libxpm4:armhf.
Preparing to unpack .../39-libxpm4_1%3a3.5.12-1_armhf.deb ...
Unpacking libxpm4:armhf (1:3.5.12-1) ...
Selecting previously unselected package libxaw7:armhf.
Preparing to unpack .../40-libxaw7_2%3a1.0.13-1_armhf.deb ...
Unpacking libxaw7:armhf (2:1.0.13-1) ...
Selecting previously unselected package groff.
Preparing to unpack .../41-groff_1.22.3-9_armhf.deb ...
Unpacking groff (1.22.3-9) ...
Selecting previously unselected package libmarkdown2:armhf.
Preparing to unpack .../42-libmarkdown2_2.2.3b8-2_armhf.deb ...
Unpacking libmarkdown2:armhf (2.2.3b8-2) ...
Selecting previously unselected package rubygems-integration.
Preparing to unpack .../43-rubygems-integration_1.11_all.deb ...
Unpacking rubygems-integration (1.11) ...
Selecting previously unselected package ruby2.3.
Preparing to unpack .../44-ruby2.3_2.3.3-1+deb9u1+rpi1_armhf.deb ...
Unpacking ruby2.3 (2.3.3-1+deb9u1+rpi1) ...
Selecting previously unselected package ruby.
Preparing to unpack .../45-ruby_1%3a2.3.3_armhf.deb ...
Unpacking ruby (1:2.3.3) ...
Selecting previously unselected package rake.
Preparing to unpack .../46-rake_12.0.0-1_all.deb ...
Unpacking rake (12.0.0-1) ...
Selecting previously unselected package ruby-did-you-mean.
Preparing to unpack .../47-ruby-did-you-mean_1.0.0-2_all.deb ...
Unpacking ruby-did-you-mean (1.0.0-2) ...
Selecting previously unselected package ruby-minitest.
Preparing to unpack .../48-ruby-minitest_5.10.3-1_all.deb ...
Unpacking ruby-minitest (5.10.3-1) ...
Selecting previously unselected package ruby-net-telnet.
Preparing to unpack .../49-ruby-net-telnet_0.1.1-2_all.deb ...
Unpacking ruby-net-telnet (0.1.1-2) ...
Selecting previously unselected package ruby-power-assert.
Preparing to unpack .../50-ruby-power-assert_0.3.0-1_all.deb ...
Unpacking ruby-power-assert (0.3.0-1) ...
Selecting previously unselected package ruby-test-unit.
Preparing to unpack .../51-ruby-test-unit_3.2.5-1_all.deb ...
Unpacking ruby-test-unit (3.2.5-1) ...
Selecting previously unselected package libyaml-0-2:armhf.
Preparing to unpack .../52-libyaml-0-2_0.1.7-2_armhf.deb ...
Unpacking libyaml-0-2:armhf (0.1.7-2) ...
Selecting previously unselected package libruby2.3:armhf.
Preparing to unpack .../53-libruby2.3_2.3.3-1+deb9u1+rpi1_armhf.deb ...
Unpacking libruby2.3:armhf (2.3.3-1+deb9u1+rpi1) ...
Selecting previously unselected package python-markdown.
Preparing to unpack .../54-python-markdown_2.6.9-1_all.deb ...
Unpacking python-markdown (2.6.9-1) ...
Selecting previously unselected package ruby-fast-xs.
Preparing to unpack .../55-ruby-fast-xs_0.8.0-3+b4_armhf.deb ...
Unpacking ruby-fast-xs (0.8.0-3+b4) ...
Selecting previously unselected package ruby-hpricot.
Preparing to unpack .../56-ruby-hpricot_0.8.6-6+b1_armhf.deb ...
Unpacking ruby-hpricot (0.8.6-6+b1) ...
Selecting previously unselected package ruby-mustache.
Preparing to unpack .../57-ruby-mustache_1.0.2-1_all.deb ...
Unpacking ruby-mustache (1.0.2-1) ...
Selecting previously unselected package ruby-rdiscount.
Preparing to unpack .../58-ruby-rdiscount_2.1.8-1+b1_armhf.deb ...
Unpacking ruby-rdiscount (2.1.8-1+b1) ...
Selecting previously unselected package ruby-ronn.
Preparing to unpack .../59-ruby-ronn_0.7.3-5_all.deb ...
Unpacking ruby-ronn (0.7.3-5) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../60-zlib1g-dev_1%3a1.2.8.dfsg-5_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.8.dfsg-5) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../61-sbuild-build-depends-seqprep-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up libexpat1:armhf (2.2.3-2) ...
Setting up libarchive-zip-perl (1.59-1) ...
Setting up mime-support (3.60) ...
Setting up libtimedate-perl (2.3000-2) ...
Setting up libsigsegv2:armhf (2.11-1) ...
Setting up groff-base (1.22.3-9) ...
Setting up libglib2.0-0:armhf (2.54.1-1) ...
No schema files found: doing nothing.
Setting up gettext-base (0.19.8.1-4) ...
Setting up libpipeline1:armhf (1.5.0-1) ...
Setting up m4 (1.4.18-1) ...
Setting up libicu57:armhf (57.1-8) ...
Setting up libbsd0:armhf (0.8.6-3) ...
Setting up libxml2:armhf (2.9.4+dfsg1-5) ...
Setting up libmagic-mgc (1:5.32-1) ...
Setting up libmagic1:armhf (1:5.32-1) ...
Setting up libcroco3:armhf (0.6.12-1) ...
Setting up libssl1.0.2:armhf (1.0.2m-3) ...
Setting up ruby-did-you-mean (1.0.0-2) ...
Setting up libyaml-0-2:armhf (0.1.7-2) ...
Processing triggers for libc-bin (2.24-17) ...
Setting up autotools-dev (20161112.1+nmu1) ...
Setting up libssl1.1:armhf (1.1.0g-2) ...
Processing triggers for systemd (235-3) ...
Setting up openssl (1.1.0g-2) ...
Setting up ruby-net-telnet (0.1.1-2) ...
Setting up libmarkdown2:armhf (2.2.3b8-2) ...
Setting up libxdmcp6:armhf (1:1.1.2-3) ...
Setting up bsdmainutils (9.0.14) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up ruby-minitest (5.10.3-1) ...
Setting up x11-common (1:7.7+19) ...
update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
invoke-rc.d: could not determine current runlevel
All runlevel operations denied by policy
invoke-rc.d: policy-rc.d denied execution of start.
Setting up ca-certificates (20170717) ...
Updating certificates in /etc/ssl/certs...
148 added, 0 removed; done.
Setting up libx11-data (2:1.6.4-3) ...
Setting up libpython2.7-stdlib:armhf (2.7.14-2) ...
Setting up libxau6:armhf (1:1.0.8-1+b2) ...
Setting up autopoint (0.19.8.1-4) ...
Setting up ruby-power-assert (0.3.0-1) ...
Setting up zlib1g-dev:armhf (1:1.2.8.dfsg-5) ...
Setting up libfile-stripnondeterminism-perl (0.040-1) ...
Setting up gettext (0.19.8.1-4) ...
Setting up python2.7 (2.7.14-2) ...
Setting up autoconf (2.69-11) ...
Setting up file (1:5.32-1) ...
Setting up libpython-stdlib:armhf (2.7.14-1) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up automake (1:1.15.1-3) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Setting up libice6:armhf (2:1.0.9-2) ...
Setting up rubygems-integration (1.11) ...
Setting up man-db (2.7.6.1-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libxcb1:armhf (1.12-1) ...
Setting up python (2.7.14-1) ...
Setting up python-markdown (2.6.9-1) ...
Setting up libtool (2.4.6-2) ...
Setting up libsm6:armhf (2:1.2.2-1+b3) ...
Setting up po-debconf (1.0.20) ...
Setting up libx11-6:armhf (2:1.6.4-3) ...
Setting up libxpm4:armhf (1:3.5.12-1) ...
Setting up libxt6:armhf (1:1.1.5-1) ...
Setting up libxext6:armhf (2:1.3.3-1+b2) ...
Setting up libxmu6:armhf (2:1.1.2-2) ...
Setting up libxaw7:armhf (2:1.0.13-1) ...
Setting up groff (1.22.3-9) ...
Setting up dh-autoreconf (15) ...
Setting up rake (12.0.0-1) ...
Setting up ruby2.3 (2.3.3-1+deb9u1+rpi1) ...
Setting up dh-strip-nondeterminism (0.040-1) ...
Setting up ruby (1:2.3.3) ...
Setting up debhelper (10.10.5) ...
Setting up ruby-mustache (1.0.2-1) ...
Setting up ruby-test-unit (3.2.5-1) ...
Setting up libruby2.3:armhf (2.3.3-1+deb9u1+rpi1) ...
Setting up ruby-rdiscount (2.1.8-1+b1) ...
Setting up ruby-fast-xs (0.8.0-3+b4) ...
Setting up ruby-hpricot (0.8.6-6+b1) ...
Setting up ruby-ronn (0.7.3-5) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.24-17) ...
Processing triggers for systemd (235-3) ...
Processing triggers for ca-certificates (20170717) ...
Updating certificates in /etc/ssl/certs...
0 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 4.9.0-0.bpo.4-armmp armhf (armv7l)
Toolchain package versions: binutils_2.29.1-6+rpi1 dpkg-dev_1.19.0.4 g++-7_7.2.0-14 gcc-7_7.2.0-14 libc6-dev_2.24-17 libstdc++-7-dev_7.2.0-14 libstdc++6_7.2.0-14 linux-libc-dev_4.9.51-1+rpi3+b1
Package versions: adduser_3.116 apt_1.6~alpha5 autoconf_2.69-11 automake_1:1.15.1-3 autopoint_0.19.8.1-4 autotools-dev_20161112.1+nmu1 base-files_10+rpi1 base-passwd_3.5.44 bash_4.4-5 binutils_2.29.1-6+rpi1 binutils-arm-linux-gnueabihf_2.29.1-6+rpi1 binutils-common_2.29.1-6+rpi1 bsdmainutils_9.0.14 bsdutils_1:2.30.2-0.1 build-essential_12.4 bzip2_1.0.6-8.1 ca-certificates_20170717 coreutils_8.28-1 cpio_2.11+dfsg-6 cpp_4:7.2.0-1d1 cpp-7_7.2.0-14 dash_0.5.8-2.5 debconf_1.5.65 debhelper_10.10.5 debianutils_4.8.3 dh-autoreconf_15 dh-strip-nondeterminism_0.040-1 diffutils_1:3.6-1 dirmngr_2.2.2-1+rpi1 dmsetup_2:1.02.145-4 dpkg_1.19.0.4 dpkg-dev_1.19.0.4 e2fslibs_1.43.7-1 e2fsprogs_1.43.7-1 fakeroot_1.22-2 fdisk_2.30.2-0.1 file_1:5.32-1 findutils_4.6.0+git+20170828-2 g++_4:7.2.0-1d1 g++-7_7.2.0-14 gcc_4:7.2.0-1d1 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-11+rpi1 gcc-4.8-base_4.8.5-4 gcc-4.9-base_4.9.3-14 gcc-5-base_5.4.1-4 gcc-6-base_6.4.0-10 gcc-7_7.2.0-14 gcc-7-base_7.2.0-14 gettext_0.19.8.1-4 gettext-base_0.19.8.1-4 gnupg_2.2.2-1+rpi1 gnupg-l10n_2.2.2-1+rpi1 gnupg-utils_2.2.2-1+rpi1 gpg_2.2.2-1+rpi1 gpg-agent_2.2.2-1+rpi1 gpg-wks-client_2.2.2-1+rpi1 gpg-wks-server_2.2.2-1+rpi1 gpgconf_2.2.2-1+rpi1 gpgsm_2.2.2-1+rpi1 gpgv_2.2.2-1+rpi1 grep_3.1-2 groff_1.22.3-9 groff-base_1.22.3-9 gzip_1.6-5 hostname_3.18 init-system-helpers_1.51 initramfs-tools_0.130 initramfs-tools-core_0.130 intltool-debian_0.35.0+20060710.4 klibc-utils_2.0.4-9+rpi1 kmod_24-1 libacl1_2.2.52-3 libapparmor1_2.11.1-3 libapt-pkg5.0_1.6~alpha5 libarchive-zip-perl_1.59-1 libasan4_7.2.0-14 libassuan0_2.4.3-3 libatomic1_7.2.0-14 libattr1_1:2.4.47-2 libaudit-common_1:2.8.1-2 libaudit1_1:2.8.1-2 libbinutils_2.29.1-6+rpi1 libblkid1_2.30.2-0.1 libbsd0_0.8.6-3 libbz2-1.0_1.0.6-8.1 libc-bin_2.24-17 libc-dev-bin_2.24-17 libc6_2.24-17 libc6-dev_2.24-17 libcap-ng0_0.7.7-3.1+b1 libcap2_1:2.25-1.1 libcc1-0_7.2.0-14 libcilkrts5_7.2.0-14 libcomerr2_1.43.7-1 libcroco3_0.6.12-1 libcryptsetup4_2:1.7.5-1 libdb5.3_5.3.28-13.1 libdbus-1-3_1.12.0-1 libdebconfclient0_0.232 libdevmapper1.02.1_2:1.02.145-4 libdpkg-perl_1.19.0.4 libdrm-common_2.4.85-1+rpi1 libdrm2_2.4.85-1+rpi1 libexpat1_2.2.3-2 libfakeroot_1.22-2 libfdisk1_2.30.2-0.1 libffi6_3.2.1-6 libfile-stripnondeterminism-perl_0.040-1 libgcc-7-dev_7.2.0-14 libgcc1_1:7.2.0-14 libgcrypt20_1.8.1-4 libgdbm3_1.8.3-14 libglib2.0-0_2.54.1-1 libgmp10_2:6.1.2+dfsg-1.1 libgnutls30_3.5.16-1 libgomp1_7.2.0-14 libgpg-error0_1.27-5 libhogweed4_3.3-2 libice6_2:1.0.9-2 libicu57_57.1-8 libidn11_1.33-2 libidn2-0_2.0.2-5 libip4tc0_1.6.1-2+b1 libisl15_0.18-1 libklibc_2.0.4-9+rpi1 libkmod2_24-1 libksba8_1.3.5-2 libldap-2.4-2_2.4.45+dfsg-1 libldap-common_2.4.45+dfsg-1 liblocale-gettext-perl_1.07-3+b2 liblz4-1_0.0~r131-2 liblzma5_5.2.2-1.3 libmagic-mgc_1:5.32-1 libmagic1_1:5.32-1 libmarkdown2_2.2.3b8-2 libmount1_2.30.2-0.1 libmpc3_1.0.3-2 libmpfr4_3.1.6-1 libncurses5_6.0+20170902-1 libncursesw5_6.0+20170902-1 libnettle6_3.3-2 libnih-dbus1_1.0.3-8 libnih1_1.0.3-8 libnpth0_1.5-3 libp11-kit0_0.23.9-2 libpam-modules_1.1.8-3.6 libpam-modules-bin_1.1.8-3.6 libpam-runtime_1.1.8-3.6 libpam0g_1.1.8-3.6 libpcre3_2:8.39-4 libperl5.26_5.26.1-2 libpipeline1_1.5.0-1 libplymouth4_0.9.3-1 libpng16-16_1.6.34-1 libprocps6_2:3.3.12-3 libpython-stdlib_2.7.14-1 libpython2.7-minimal_2.7.14-2 libpython2.7-stdlib_2.7.14-2 libreadline7_7.0-3 libruby2.3_2.3.3-1+deb9u1+rpi1 libsasl2-2_2.1.27~101-g0780600+dfsg-3 libsasl2-modules-db_2.1.27~101-g0780600+dfsg-3 libseccomp2_2.3.1-2.1 libselinux1_2.7-2 libsemanage-common_2.7-2 libsemanage1_2.7-2 libsepol1_2.7-1 libsigsegv2_2.11-1 libsm6_2:1.2.2-1+b3 libsmartcols1_2.30.2-0.1 libsqlite3-0_3.21.0-1 libss2_1.43.7-1 libssl1.0.2_1.0.2m-3 libssl1.1_1.1.0g-2 libstdc++-7-dev_7.2.0-14 libstdc++6_7.2.0-14 libsystemd0_235-3 libtasn1-6_4.12-2.1 libtext-charwidth-perl_0.04-7.1 libtext-iconv-perl_1.7-5+b9 libtext-wrapi18n-perl_0.06-7.1 libtimedate-perl_2.3000-2 libtinfo5_6.0+20170902-1 libtool_2.4.6-2 libubsan0_7.2.0-14 libudev1_235-3 libunistring2_0.9.7-2 libuuid1_2.30.2-0.1 libx11-6_2:1.6.4-3 libx11-data_2:1.6.4-3 libxau6_1:1.0.8-1+b2 libxaw7_2:1.0.13-1 libxcb1_1.12-1 libxdmcp6_1:1.1.2-3 libxext6_2:1.3.3-1+b2 libxml2_2.9.4+dfsg1-5 libxmu6_2:1.1.2-2 libxpm4_1:3.5.12-1 libxt6_1:1.1.5-1 libyaml-0-2_0.1.7-2 linux-base_4.5 linux-libc-dev_4.9.51-1+rpi3+b1 login_1:4.5-1 lsb-base_9.20170808+rpi1 m4_1.4.18-1 make_4.1-9.1 makedev_2.3.1-93 man-db_2.7.6.1-2 mawk_1.3.3-17 mime-support_3.60 mount_2.30.2-0.1 mountall_2.54 multiarch-support_2.24-17 ncurses-base_6.0+20170902-1 ncurses-bin_6.0+20170902-1 openssl_1.1.0g-2 passwd_1:4.5-1 patch_2.7.5-1 perl_5.26.1-2 perl-base_5.26.1-2 perl-modules-5.26_5.26.1-2 pinentry-curses_1.0.0-3 plymouth_0.9.3-1 po-debconf_1.0.20 procps_2:3.3.12-3 python_2.7.14-1 python-markdown_2.6.9-1 python-minimal_2.7.14-1 python2.7_2.7.14-2 python2.7-minimal_2.7.14-2 rake_12.0.0-1 raspbian-archive-keyring_20120528.2 readline-common_7.0-3 ruby_1:2.3.3 ruby-did-you-mean_1.0.0-2 ruby-fast-xs_0.8.0-3+b4 ruby-hpricot_0.8.6-6+b1 ruby-minitest_5.10.3-1 ruby-mustache_1.0.2-1 ruby-net-telnet_0.1.1-2 ruby-power-assert_0.3.0-1 ruby-rdiscount_2.1.8-1+b1 ruby-ronn_0.7.3-5 ruby-test-unit_3.2.5-1 ruby2.3_2.3.3-1+deb9u1+rpi1 rubygems-integration_1.11 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.4-1 sensible-utils_0.0.11 systemd_235-3 sysvinit-utils_2.88dsf-59.10 tar_1.29b-2 tzdata_2017c-1 udev_235-3 util-linux_2.30.2-0.1 x11-common_1:7.7+19 xz-utils_5.2.2-1.3 zlib1g_1:1.2.8.dfsg-5 zlib1g-dev_1:1.2.8.dfsg-5
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/sbuild-nonexistent/.gnupg/trustedkeys.kbx': General error
gpgv: Signature made Fri Nov 17 21:31:58 2017 UTC
gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv: issuer "tillea@rki.de"
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-2.dsc
dpkg-source: info: extracting seqprep in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.3.2-2.debian.tar.xz
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
Check disc space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=root
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=buster-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=buster-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=buster-staging-armhf-sbuild-05bb5c2f-4b37-45dd-8f5a-92ab587e9be0
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=xterm
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: info: source package seqprep
dpkg-buildpackage: info: source version 1.3.2-2
dpkg-buildpackage: info: source distribution unstable
dpkg-source --before-build seqprep-1.3.2
dpkg-buildpackage: info: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_auto_clean
make -j4 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
rm -f SeqPrep.o utils.o stdaln.o SeqPrep
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean
rm -f seqprep
rm -f debian/*.1
rm -f README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules build-arch
dh build-arch
dh_update_autotools_config -a
dh_autoreconf -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build
make -j4
make[2]: Entering directory '/<<PKGBUILDDIR>>'
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o
SeqPrep.c: In function 'main':
SeqPrep.c:166:15: warning: implicit declaration of function 'getopt'; did you mean 'getgid'? [-Wimplicit-function-declaration]
while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) {
^~~~~~
getgid
cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
cp SeqPrep seqprep
TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn
roff: debian/seqprep.1
markdown_py -f README.html README.md
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.944468
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.826348
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
create-stamp debian/debhelper-build-stamp
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j4 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
Makefile:15: recipe for target 'install' failed
make[1]: [install] Error 1 (ignored)
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_strip_nondeterminism -a
dh_compress -a
dh_fixperms -a
dh_missing -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dpkg-shlibdeps: warning: package could avoid a useless dependency if debian/seqprep/usr/bin/seqprep was not linked against ld-linux-armhf.so.3 (it uses none of the library's symbols)
dh_installdeb -a
dh_gencontrol -a
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-2_armhf.deb'.
dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-2_armhf.deb'.
dpkg-genbuildinfo --build=any
dpkg-genchanges --build=any -mRaspbian wandboard test autobuilder <root@raspbian.org> >../seqprep_1.3.2-2_armhf.changes
dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build seqprep-1.3.2
dpkg-buildpackage: info: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 2017-11-23T05:53:57Z
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
seqprep_1.3.2-2_armhf.changes:
------------------------------
Format: 1.8
Date: Fri, 17 Nov 2017 22:31:35 +0100
Source: seqprep
Binary: seqprep seqprep-data
Architecture: armhf
Version: 1.3.2-2
Distribution: buster-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
seqprep-data - example data set for seqprep - only used for testing
Changes:
seqprep (1.3.2-2) unstable; urgency=medium
.
* Moved packaging from SVN to Git
* Standards-Version: 4.1.1
* Data package Priority: optional
* Drop unused lintian override
Checksums-Sha1:
76b66a6eb02b5fbfd313ea4b2770cc997d193583 16236 seqprep-dbgsym_1.3.2-2_armhf.deb
82809f41f68ba4c2cf45828d0d866cc46d6c01ad 5720 seqprep_1.3.2-2_armhf.buildinfo
8afde5d406a5dc668cd39d05eb2c0807b2e39521 26956 seqprep_1.3.2-2_armhf.deb
Checksums-Sha256:
b97217c8b56143f547a37e04005563eea4cbae9ab965eaaeefdcdbee0f50faef 16236 seqprep-dbgsym_1.3.2-2_armhf.deb
8001c6774517b55d4699c39b1baa49bab08318590c364fcd3885d6338ec04305 5720 seqprep_1.3.2-2_armhf.buildinfo
0b4ae96058e8d4047cf83d8cd92f50ca10982db9256c0f9f3b5f6f3d27ec980a 26956 seqprep_1.3.2-2_armhf.deb
Files:
2e8e977c82461df052cef648d905ed04 16236 debug optional seqprep-dbgsym_1.3.2-2_armhf.deb
27c8b63ee082ed94f7ac9e405aa5edaf 5720 science optional seqprep_1.3.2-2_armhf.buildinfo
ea7aee7d574bb73b7b24bef1b4e15061 26956 science optional seqprep_1.3.2-2_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
seqprep-dbgsym_1.3.2-2_armhf.deb
--------------------------------
new Debian package, version 2.0.
size 16236 bytes: control archive=532 bytes.
369 bytes, 12 lines control
106 bytes, 1 lines md5sums
Package: seqprep-dbgsym
Source: seqprep
Version: 1.3.2-2
Auto-Built-Package: debug-symbols
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 31
Depends: seqprep (= 1.3.2-2)
Section: debug
Priority: optional
Description: debug symbols for seqprep
Build-Ids: 65604c3f66d8eff4764bd978f370684c6e4543ad
drwxr-xr-x root/root 0 2017-11-17 21:31 ./
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/lib/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/lib/debug/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/lib/debug/.build-id/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/lib/debug/.build-id/65/
-rw-r--r-- root/root 21488 2017-11-17 21:31 ./usr/lib/debug/.build-id/65/604c3f66d8eff4764bd978f370684c6e4543ad.debug
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/doc/
lrwxrwxrwx root/root 0 2017-11-17 21:31 ./usr/share/doc/seqprep-dbgsym -> seqprep
seqprep_1.3.2-2_armhf.deb
-------------------------
new Debian package, version 2.0.
size 26956 bytes: control archive=1108 bytes.
1172 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.3.2-2
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 122
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2017-11-17 21:31 ./
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/bin/
-rwxr-xr-x root/root 94704 2017-11-17 21:31 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/doc/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11749 2017-11-17 21:31 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 943 2017-11-17 21:31 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1439 2017-11-17 21:26 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/man/
drwxr-xr-x root/root 0 2017-11-17 21:31 ./usr/share/man/man1/
-rw-r--r-- root/root 4568 2017-11-17 21:31 ./usr/share/man/man1/seqprep.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 65052
Build-Time: 264
Distribution: buster-staging
Host Architecture: armhf
Install-Time: 580
Job: seqprep_1.3.2-2
Machine Architecture: armhf
Package: seqprep
Package-Time: 901
Source-Version: 1.3.2-2
Space: 65052
Status: successful
Version: 1.3.2-2
--------------------------------------------------------------------------------
Finished at 2017-11-23T05:53:57Z
Build needed 00:15:01, 65052k disc space