seqprep →
1.3.2-1 →
armhf → 2017-01-28 06:16:27
sbuild (Debian sbuild) 0.71.0 (24 Aug 2016) on testwandboard
+==============================================================================+
| seqprep 1.3.2-1 (armhf) Sat, 28 Jan 2017 06:03:44 +0000 |
+==============================================================================+
Package: seqprep
Version: 1.3.2-1
Source Version: 1.3.2-1
Distribution: stretch-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/stretch-staging-armhf-sbuild-49509c06-0003-4f72-ae33-07c57ef700a0' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private stretch-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private stretch-staging/main Sources [9731 kB]
Get:3 http://172.17.0.1/private stretch-staging/main armhf Packages [11.7 MB]
Fetched 21.4 MB in 27s (783 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'seqprep' packaging is maintained in the 'Svn' version control system at:
svn://anonscm.debian.org/debian-med/trunk/packages/seqprep/trunk/
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private stretch-staging/main seqprep 1.3.2-1 (dsc) [2126 B]
Get:2 http://172.17.0.1/private stretch-staging/main seqprep 1.3.2-1 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private stretch-staging/main seqprep 1.3.2-1 (diff) [9332 B]
Fetched 37.2 MB in 12s (3023 kB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/seqprep-SQnbB6/seqprep-1.3.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/seqprep-SQnbB6' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install build-essential |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-xsANat/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-xsANat/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-xsANat/gpg/trustdb.gpg: trustdb created
gpg: key 35506D9A48F77B2E: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg: imported: 1
gpg: key 35506D9A48F77B2E: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 35506D9A48F77B2E: secret key imported
gpg: Total number processed: 1
gpg: unchanged: 1
gpg: secret keys read: 1
gpg: secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Packages [432 B]
Fetched 2108 B in 0s (3011 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install core build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
fuse2fs gnupg-l10n kbd libfuse2 manpages netbase psmisc
Use 'apt autoremove' to remove them.
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 63 not upgraded.
Need to get 772 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [772 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 772 B in 0s (0 B/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 13244 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (armhf included in any all)
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper (>= 10), python, python-markdown, ruby-ronn, zlib1g-dev
Filtered Build-Depends: debhelper (>= 10), python, python-markdown, ruby-ronn, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<<BUILDDIR>>/resolver-xsANat/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy sbuild-build-depends-seqprep-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Sources [519 B]
Get:5 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ Packages [598 B]
Fetched 2450 B in 0s (3701 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install seqprep build dependencies (apt-based resolver)
-------------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
fuse2fs gnupg-l10n kbd libfuse2 manpages netbase psmisc
Use 'apt autoremove' to remove them.
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libffi6 libfile-stripnondeterminism-perl libglib2.0-0 libice6
libicu57 libmagic-mgc libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libssl1.0.2 libssl1.1 libtimedate-perl libtool libunistring0 libx11-6
libx11-data libxau6 libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6
libxpm4 libxt6 libyaml-0-2 m4 man-db mime-support openssl po-debconf python
python-markdown python-minimal python2.7 python2.7-minimal rake ruby
ruby-did-you-mean ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache
ruby-net-telnet ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit
ruby2.3 rubygems-integration x11-common zlib1g zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
vacation dh-make gettext-doc libasprintf-dev libgettextpo-dev libtool-doc
gfortran | fortran95-compiler gcj-jdk m4-doc less www-browser
libmail-box-perl python-doc python-tk python-markdown-doc python2.7-doc
binfmt-support ri ruby-dev bundler
Recommended packages:
curl | wget | lynx-cur ghostscript imagemagick libpaper1 netpbm psutils
libglib2.0-data shared-mime-info xdg-user-dirs libltdl-dev xml-core
libmail-sendmail-perl python-pygments python-yaml zip fonts-lato
libjs-jquery
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libffi6 libfile-stripnondeterminism-perl libglib2.0-0 libice6
libicu57 libmagic-mgc libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libssl1.0.2 libssl1.1 libtimedate-perl libtool libunistring0 libx11-6
libx11-data libxau6 libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6
libxpm4 libxt6 libyaml-0-2 m4 man-db mime-support openssl po-debconf python
python-markdown python-minimal python2.7 python2.7-minimal rake ruby
ruby-did-you-mean ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache
ruby-net-telnet ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit
ruby2.3 rubygems-integration sbuild-build-depends-seqprep-dummy x11-common
zlib1g-dev
The following packages will be upgraded:
zlib1g
1 upgraded, 78 newly installed, 0 to remove and 62 not upgraded.
Need to get 34.7 MB/34.8 MB of archives.
After this operation, 117 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-xsANat/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [802 B]
Get:2 http://172.17.0.1/private stretch-staging/main armhf groff-base armhf 1.22.3-9 [1005 kB]
Get:3 http://172.17.0.1/private stretch-staging/main armhf libbsd0 armhf 0.8.3-1 [89.0 kB]
Get:4 http://172.17.0.1/private stretch-staging/main armhf bsdmainutils armhf 9.0.12 [178 kB]
Get:5 http://172.17.0.1/private stretch-staging/main armhf libpipeline1 armhf 1.4.1-2 [23.7 kB]
Get:6 http://172.17.0.1/private stretch-staging/main armhf zlib1g armhf 1:1.2.8.dfsg-4 [81.6 kB]
Get:7 http://172.17.0.1/private stretch-staging/main armhf man-db armhf 2.7.6.1-2 [1014 kB]
Get:8 http://172.17.0.1/private stretch-staging/main armhf libpython2.7-minimal armhf 2.7.13-1 [389 kB]
Get:9 http://172.17.0.1/private stretch-staging/main armhf python2.7-minimal armhf 2.7.13-1 [1180 kB]
Get:10 http://172.17.0.1/private stretch-staging/main armhf python-minimal armhf 2.7.13-1 [40.5 kB]
Get:11 http://172.17.0.1/private stretch-staging/main armhf mime-support all 3.60 [36.7 kB]
Get:12 http://172.17.0.1/private stretch-staging/main armhf libexpat1 armhf 2.2.0-2 [62.2 kB]
Get:13 http://172.17.0.1/private stretch-staging/main armhf libssl1.1 armhf 1.1.0c-2 [1101 kB]
Get:14 http://172.17.0.1/private stretch-staging/main armhf libpython2.7-stdlib armhf 2.7.13-1 [1828 kB]
Get:15 http://172.17.0.1/private stretch-staging/main armhf python2.7 armhf 2.7.13-1 [285 kB]
Get:16 http://172.17.0.1/private stretch-staging/main armhf libpython-stdlib armhf 2.7.13-1 [19.9 kB]
Get:17 http://172.17.0.1/private stretch-staging/main armhf python armhf 2.7.13-1 [154 kB]
Get:18 http://172.17.0.1/private stretch-staging/main armhf libxau6 armhf 1:1.0.8-1 [19.9 kB]
Get:19 http://172.17.0.1/private stretch-staging/main armhf libxdmcp6 armhf 1:1.1.2-1.1 [24.9 kB]
Get:20 http://172.17.0.1/private stretch-staging/main armhf libxcb1 armhf 1.12-1 [129 kB]
Get:21 http://172.17.0.1/private stretch-staging/main armhf libx11-data all 2:1.6.4-2 [290 kB]
Get:22 http://172.17.0.1/private stretch-staging/main armhf libx11-6 armhf 2:1.6.4-2 [681 kB]
Get:23 http://172.17.0.1/private stretch-staging/main armhf libxext6 armhf 2:1.3.3-1 [48.1 kB]
Get:24 http://172.17.0.1/private stretch-staging/main armhf libssl1.0.2 armhf 1.0.2j-5 [891 kB]
Get:25 http://172.17.0.1/private stretch-staging/main armhf libmagic-mgc armhf 1:5.29-2 [221 kB]
Get:26 http://172.17.0.1/private stretch-staging/main armhf libmagic1 armhf 1:5.29-2 [104 kB]
Get:27 http://172.17.0.1/private stretch-staging/main armhf file armhf 1:5.29-2 [63.1 kB]
Get:28 http://172.17.0.1/private stretch-staging/main armhf gettext-base armhf 0.19.8.1-1 [117 kB]
Get:29 http://172.17.0.1/private stretch-staging/main armhf libicu57 armhf 57.1-5 [7427 kB]
Get:30 http://172.17.0.1/private stretch-staging/main armhf libxml2 armhf 2.9.4+dfsg1-2.1 [804 kB]
Get:31 http://172.17.0.1/private stretch-staging/main armhf libsigsegv2 armhf 2.10-5 [28.4 kB]
Get:32 http://172.17.0.1/private stretch-staging/main armhf m4 armhf 1.4.18-1 [185 kB]
Get:33 http://172.17.0.1/private stretch-staging/main armhf autoconf all 2.69-10 [338 kB]
Get:34 http://172.17.0.1/private stretch-staging/main armhf autotools-dev all 20161112.1 [73.4 kB]
Get:35 http://172.17.0.1/private stretch-staging/main armhf automake all 1:1.15-5 [733 kB]
Get:36 http://172.17.0.1/private stretch-staging/main armhf autopoint all 0.19.8.1-1 [433 kB]
Get:37 http://172.17.0.1/private stretch-staging/main armhf openssl armhf 1.1.0c-2 [703 kB]
Get:38 http://172.17.0.1/private stretch-staging/main armhf ca-certificates all 20161130 [203 kB]
Get:39 http://172.17.0.1/private stretch-staging/main armhf libtool all 2.4.6-2 [545 kB]
Get:40 http://172.17.0.1/private stretch-staging/main armhf dh-autoreconf all 13 [15.8 kB]
Get:41 http://172.17.0.1/private stretch-staging/main armhf libarchive-zip-perl all 1.59-1 [95.5 kB]
Get:42 http://172.17.0.1/private stretch-staging/main armhf libfile-stripnondeterminism-perl all 0.029-2 [15.3 kB]
Get:43 http://172.17.0.1/private stretch-staging/main armhf libtimedate-perl all 2.3000-2 [42.2 kB]
Get:44 http://172.17.0.1/private stretch-staging/main armhf dh-strip-nondeterminism all 0.029-2 [9330 B]
Get:45 http://172.17.0.1/private stretch-staging/main armhf libglib2.0-0 armhf 2.50.2-2 [2527 kB]
Get:46 http://172.17.0.1/private stretch-staging/main armhf libcroco3 armhf 0.6.11-2 [131 kB]
Get:47 http://172.17.0.1/private stretch-staging/main armhf libunistring0 armhf 0.9.6+really0.9.3-0.1 [252 kB]
Get:48 http://172.17.0.1/private stretch-staging/main armhf gettext armhf 0.19.8.1-1 [1433 kB]
Get:49 http://172.17.0.1/private stretch-staging/main armhf intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:50 http://172.17.0.1/private stretch-staging/main armhf po-debconf all 1.0.20 [247 kB]
Get:51 http://172.17.0.1/private stretch-staging/main armhf debhelper all 10.2.3 [829 kB]
Get:52 http://172.17.0.1/private stretch-staging/main armhf x11-common all 1:7.7+18 [251 kB]
Get:53 http://172.17.0.1/private stretch-staging/main armhf libice6 armhf 2:1.0.9-1+b1 [51.9 kB]
Get:54 http://172.17.0.1/private stretch-staging/main armhf libsm6 armhf 2:1.2.2-1+b1 [31.2 kB]
Get:55 http://172.17.0.1/private stretch-staging/main armhf libxt6 armhf 1:1.1.5-1 [155 kB]
Get:56 http://172.17.0.1/private stretch-staging/main armhf libxmu6 armhf 2:1.1.2-2 [52.0 kB]
Get:57 http://172.17.0.1/private stretch-staging/main armhf libxpm4 armhf 1:3.5.12-1 [43.6 kB]
Get:58 http://172.17.0.1/private stretch-staging/main armhf libxaw7 armhf 2:1.0.13-1 [164 kB]
Get:59 http://172.17.0.1/private stretch-staging/main armhf groff armhf 1.22.3-9 [3072 kB]
Get:60 http://172.17.0.1/private stretch-staging/main armhf libmarkdown2 armhf 2.2.1-1 [28.5 kB]
Get:61 http://172.17.0.1/private stretch-staging/main armhf rubygems-integration all 1.11 [4994 B]
Get:62 http://172.17.0.1/private stretch-staging/main armhf ruby2.3 armhf 2.3.3-1 [186 kB]
Get:63 http://172.17.0.1/private stretch-staging/main armhf ruby armhf 1:2.3.3 [10.8 kB]
Get:64 http://172.17.0.1/private stretch-staging/main armhf rake all 10.5.0-2 [49.4 kB]
Get:65 http://172.17.0.1/private stretch-staging/main armhf ruby-did-you-mean all 1.0.0-2 [11.2 kB]
Get:66 http://172.17.0.1/private stretch-staging/main armhf ruby-minitest all 5.9.0-1 [51.1 kB]
Get:67 http://172.17.0.1/private stretch-staging/main armhf ruby-net-telnet all 0.1.1-2 [12.5 kB]
Get:68 http://172.17.0.1/private stretch-staging/main armhf ruby-power-assert all 0.3.0-1 [7902 B]
Get:69 http://172.17.0.1/private stretch-staging/main armhf ruby-test-unit all 3.1.7-2 [69.6 kB]
Get:70 http://172.17.0.1/private stretch-staging/main armhf libyaml-0-2 armhf 0.1.7-2 [39.9 kB]
Get:71 http://172.17.0.1/private stretch-staging/main armhf libruby2.3 armhf 2.3.3-1 [2864 kB]
Get:72 http://172.17.0.1/private stretch-staging/main armhf python-markdown all 2.6.7-1 [56.4 kB]
Get:73 http://172.17.0.1/private stretch-staging/main armhf ruby-fast-xs armhf 0.8.0-3+b4 [8562 B]
Get:74 http://172.17.0.1/private stretch-staging/main armhf ruby-hpricot armhf 0.8.6-6+b1 [66.0 kB]
Get:75 http://172.17.0.1/private stretch-staging/main armhf ruby-mustache all 1.0.2-1 [25.1 kB]
Get:76 http://172.17.0.1/private stretch-staging/main armhf ruby-rdiscount armhf 2.1.8-1+b1 [32.9 kB]
Get:77 http://172.17.0.1/private stretch-staging/main armhf ruby-ronn all 0.7.3-5 [29.8 kB]
Get:78 http://172.17.0.1/private stretch-staging/main armhf zlib1g-dev armhf 1:1.2.8.dfsg-4 [198 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 34.7 MB in 10s (3350 kB/s)
Selecting previously unselected package groff-base.
(Reading database ... 13244 files and directories currently installed.)
Preparing to unpack .../0-groff-base_1.22.3-9_armhf.deb ...
Unpacking groff-base (1.22.3-9) ...
Selecting previously unselected package libbsd0:armhf.
Preparing to unpack .../1-libbsd0_0.8.3-1_armhf.deb ...
Unpacking libbsd0:armhf (0.8.3-1) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../2-bsdmainutils_9.0.12_armhf.deb ...
Unpacking bsdmainutils (9.0.12) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../3-libpipeline1_1.4.1-2_armhf.deb ...
Unpacking libpipeline1:armhf (1.4.1-2) ...
Preparing to unpack .../4-zlib1g_1%3a1.2.8.dfsg-4_armhf.deb ...
Unpacking zlib1g:armhf (1:1.2.8.dfsg-4) over (1:1.2.8.dfsg-2+b1) ...
Setting up zlib1g:armhf (1:1.2.8.dfsg-4) ...
Selecting previously unselected package man-db.
(Reading database ... 13556 files and directories currently installed.)
Preparing to unpack .../00-man-db_2.7.6.1-2_armhf.deb ...
Unpacking man-db (2.7.6.1-2) ...
Selecting previously unselected package libpython2.7-minimal:armhf.
Preparing to unpack .../01-libpython2.7-minimal_2.7.13-1_armhf.deb ...
Unpacking libpython2.7-minimal:armhf (2.7.13-1) ...
Selecting previously unselected package python2.7-minimal.
Preparing to unpack .../02-python2.7-minimal_2.7.13-1_armhf.deb ...
Unpacking python2.7-minimal (2.7.13-1) ...
Selecting previously unselected package python-minimal.
Preparing to unpack .../03-python-minimal_2.7.13-1_armhf.deb ...
Unpacking python-minimal (2.7.13-1) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../04-mime-support_3.60_all.deb ...
Unpacking mime-support (3.60) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../05-libexpat1_2.2.0-2_armhf.deb ...
Unpacking libexpat1:armhf (2.2.0-2) ...
Selecting previously unselected package libffi6:armhf.
Preparing to unpack .../06-libffi6_3.2.1-6_armhf.deb ...
Unpacking libffi6:armhf (3.2.1-6) ...
Selecting previously unselected package libssl1.1:armhf.
Preparing to unpack .../07-libssl1.1_1.1.0c-2_armhf.deb ...
Unpacking libssl1.1:armhf (1.1.0c-2) ...
Selecting previously unselected package libpython2.7-stdlib:armhf.
Preparing to unpack .../08-libpython2.7-stdlib_2.7.13-1_armhf.deb ...
Unpacking libpython2.7-stdlib:armhf (2.7.13-1) ...
Selecting previously unselected package python2.7.
Preparing to unpack .../09-python2.7_2.7.13-1_armhf.deb ...
Unpacking python2.7 (2.7.13-1) ...
Selecting previously unselected package libpython-stdlib:armhf.
Preparing to unpack .../10-libpython-stdlib_2.7.13-1_armhf.deb ...
Unpacking libpython-stdlib:armhf (2.7.13-1) ...
Setting up libpython2.7-minimal:armhf (2.7.13-1) ...
Setting up python2.7-minimal (2.7.13-1) ...
Setting up python-minimal (2.7.13-1) ...
Selecting previously unselected package python.
(Reading database ... 14603 files and directories currently installed.)
Preparing to unpack .../00-python_2.7.13-1_armhf.deb ...
Unpacking python (2.7.13-1) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../01-libxau6_1%3a1.0.8-1_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.8-1) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../02-libxdmcp6_1%3a1.1.2-1.1_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-1.1) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../03-libxcb1_1.12-1_armhf.deb ...
Unpacking libxcb1:armhf (1.12-1) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../04-libx11-data_2%3a1.6.4-2_all.deb ...
Unpacking libx11-data (2:1.6.4-2) ...
Selecting previously unselected package libx11-6:armhf.
Preparing to unpack .../05-libx11-6_2%3a1.6.4-2_armhf.deb ...
Unpacking libx11-6:armhf (2:1.6.4-2) ...
Selecting previously unselected package libxext6:armhf.
Preparing to unpack .../06-libxext6_2%3a1.3.3-1_armhf.deb ...
Unpacking libxext6:armhf (2:1.3.3-1) ...
Selecting previously unselected package libssl1.0.2:armhf.
Preparing to unpack .../07-libssl1.0.2_1.0.2j-5_armhf.deb ...
Unpacking libssl1.0.2:armhf (1.0.2j-5) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../08-libmagic-mgc_1%3a5.29-2_armhf.deb ...
Unpacking libmagic-mgc (1:5.29-2) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../09-libmagic1_1%3a5.29-2_armhf.deb ...
Unpacking libmagic1:armhf (1:5.29-2) ...
Selecting previously unselected package file.
Preparing to unpack .../10-file_1%3a5.29-2_armhf.deb ...
Unpacking file (1:5.29-2) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../11-gettext-base_0.19.8.1-1_armhf.deb ...
Unpacking gettext-base (0.19.8.1-1) ...
Selecting previously unselected package libicu57:armhf.
Preparing to unpack .../12-libicu57_57.1-5_armhf.deb ...
Unpacking libicu57:armhf (57.1-5) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../13-libxml2_2.9.4+dfsg1-2.1_armhf.deb ...
Unpacking libxml2:armhf (2.9.4+dfsg1-2.1) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../14-libsigsegv2_2.10-5_armhf.deb ...
Unpacking libsigsegv2:armhf (2.10-5) ...
Selecting previously unselected package m4.
Preparing to unpack .../15-m4_1.4.18-1_armhf.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../16-autoconf_2.69-10_all.deb ...
Unpacking autoconf (2.69-10) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../17-autotools-dev_20161112.1_all.deb ...
Unpacking autotools-dev (20161112.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../18-automake_1%3a1.15-5_all.deb ...
Unpacking automake (1:1.15-5) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../19-autopoint_0.19.8.1-1_all.deb ...
Unpacking autopoint (0.19.8.1-1) ...
Selecting previously unselected package openssl.
Preparing to unpack .../20-openssl_1.1.0c-2_armhf.deb ...
Unpacking openssl (1.1.0c-2) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../21-ca-certificates_20161130_all.deb ...
Unpacking ca-certificates (20161130) ...
Selecting previously unselected package libtool.
Preparing to unpack .../22-libtool_2.4.6-2_all.deb ...
Unpacking libtool (2.4.6-2) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../23-dh-autoreconf_13_all.deb ...
Unpacking dh-autoreconf (13) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../24-libarchive-zip-perl_1.59-1_all.deb ...
Unpacking libarchive-zip-perl (1.59-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../25-libfile-stripnondeterminism-perl_0.029-2_all.deb ...
Unpacking libfile-stripnondeterminism-perl (0.029-2) ...
Selecting previously unselected package libtimedate-perl.
Preparing to unpack .../26-libtimedate-perl_2.3000-2_all.deb ...
Unpacking libtimedate-perl (2.3000-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../27-dh-strip-nondeterminism_0.029-2_all.deb ...
Unpacking dh-strip-nondeterminism (0.029-2) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../28-libglib2.0-0_2.50.2-2_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.50.2-2) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../29-libcroco3_0.6.11-2_armhf.deb ...
Unpacking libcroco3:armhf (0.6.11-2) ...
Selecting previously unselected package libunistring0:armhf.
Preparing to unpack .../30-libunistring0_0.9.6+really0.9.3-0.1_armhf.deb ...
Unpacking libunistring0:armhf (0.9.6+really0.9.3-0.1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../31-gettext_0.19.8.1-1_armhf.deb ...
Unpacking gettext (0.19.8.1-1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../32-intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../33-po-debconf_1.0.20_all.deb ...
Unpacking po-debconf (1.0.20) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../34-debhelper_10.2.3_all.deb ...
Unpacking debhelper (10.2.3) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../35-x11-common_1%3a7.7+18_all.deb ...
Unpacking x11-common (1:7.7+18) ...
Selecting previously unselected package libice6:armhf.
Preparing to unpack .../36-libice6_2%3a1.0.9-1+b1_armhf.deb ...
Unpacking libice6:armhf (2:1.0.9-1+b1) ...
Selecting previously unselected package libsm6:armhf.
Preparing to unpack .../37-libsm6_2%3a1.2.2-1+b1_armhf.deb ...
Unpacking libsm6:armhf (2:1.2.2-1+b1) ...
Selecting previously unselected package libxt6:armhf.
Preparing to unpack .../38-libxt6_1%3a1.1.5-1_armhf.deb ...
Unpacking libxt6:armhf (1:1.1.5-1) ...
Selecting previously unselected package libxmu6:armhf.
Preparing to unpack .../39-libxmu6_2%3a1.1.2-2_armhf.deb ...
Unpacking libxmu6:armhf (2:1.1.2-2) ...
Selecting previously unselected package libxpm4:armhf.
Preparing to unpack .../40-libxpm4_1%3a3.5.12-1_armhf.deb ...
Unpacking libxpm4:armhf (1:3.5.12-1) ...
Selecting previously unselected package libxaw7:armhf.
Preparing to unpack .../41-libxaw7_2%3a1.0.13-1_armhf.deb ...
Unpacking libxaw7:armhf (2:1.0.13-1) ...
Selecting previously unselected package groff.
Preparing to unpack .../42-groff_1.22.3-9_armhf.deb ...
Unpacking groff (1.22.3-9) ...
Selecting previously unselected package libmarkdown2:armhf.
Preparing to unpack .../43-libmarkdown2_2.2.1-1_armhf.deb ...
Unpacking libmarkdown2:armhf (2.2.1-1) ...
Selecting previously unselected package rubygems-integration.
Preparing to unpack .../44-rubygems-integration_1.11_all.deb ...
Unpacking rubygems-integration (1.11) ...
Selecting previously unselected package ruby2.3.
Preparing to unpack .../45-ruby2.3_2.3.3-1_armhf.deb ...
Unpacking ruby2.3 (2.3.3-1) ...
Selecting previously unselected package ruby.
Preparing to unpack .../46-ruby_1%3a2.3.3_armhf.deb ...
Unpacking ruby (1:2.3.3) ...
Selecting previously unselected package rake.
Preparing to unpack .../47-rake_10.5.0-2_all.deb ...
Unpacking rake (10.5.0-2) ...
Selecting previously unselected package ruby-did-you-mean.
Preparing to unpack .../48-ruby-did-you-mean_1.0.0-2_all.deb ...
Unpacking ruby-did-you-mean (1.0.0-2) ...
Selecting previously unselected package ruby-minitest.
Preparing to unpack .../49-ruby-minitest_5.9.0-1_all.deb ...
Unpacking ruby-minitest (5.9.0-1) ...
Selecting previously unselected package ruby-net-telnet.
Preparing to unpack .../50-ruby-net-telnet_0.1.1-2_all.deb ...
Unpacking ruby-net-telnet (0.1.1-2) ...
Selecting previously unselected package ruby-power-assert.
Preparing to unpack .../51-ruby-power-assert_0.3.0-1_all.deb ...
Unpacking ruby-power-assert (0.3.0-1) ...
Selecting previously unselected package ruby-test-unit.
Preparing to unpack .../52-ruby-test-unit_3.1.7-2_all.deb ...
Unpacking ruby-test-unit (3.1.7-2) ...
Selecting previously unselected package libyaml-0-2:armhf.
Preparing to unpack .../53-libyaml-0-2_0.1.7-2_armhf.deb ...
Unpacking libyaml-0-2:armhf (0.1.7-2) ...
Selecting previously unselected package libruby2.3:armhf.
Preparing to unpack .../54-libruby2.3_2.3.3-1_armhf.deb ...
Unpacking libruby2.3:armhf (2.3.3-1) ...
Selecting previously unselected package python-markdown.
Preparing to unpack .../55-python-markdown_2.6.7-1_all.deb ...
Unpacking python-markdown (2.6.7-1) ...
Selecting previously unselected package ruby-fast-xs.
Preparing to unpack .../56-ruby-fast-xs_0.8.0-3+b4_armhf.deb ...
Unpacking ruby-fast-xs (0.8.0-3+b4) ...
Selecting previously unselected package ruby-hpricot.
Preparing to unpack .../57-ruby-hpricot_0.8.6-6+b1_armhf.deb ...
Unpacking ruby-hpricot (0.8.6-6+b1) ...
Selecting previously unselected package ruby-mustache.
Preparing to unpack .../58-ruby-mustache_1.0.2-1_all.deb ...
Unpacking ruby-mustache (1.0.2-1) ...
Selecting previously unselected package ruby-rdiscount.
Preparing to unpack .../59-ruby-rdiscount_2.1.8-1+b1_armhf.deb ...
Unpacking ruby-rdiscount (2.1.8-1+b1) ...
Selecting previously unselected package ruby-ronn.
Preparing to unpack .../60-ruby-ronn_0.7.3-5_all.deb ...
Unpacking ruby-ronn (0.7.3-5) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../61-zlib1g-dev_1%3a1.2.8.dfsg-4_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.8.dfsg-4) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../62-sbuild-build-depends-seqprep-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up libexpat1:armhf (2.2.0-2) ...
Setting up libarchive-zip-perl (1.59-1) ...
Setting up mime-support (3.60) ...
Setting up libtimedate-perl (2.3000-2) ...
Setting up libsigsegv2:armhf (2.10-5) ...
Setting up groff-base (1.22.3-9) ...
Setting up gettext-base (0.19.8.1-1) ...
Setting up libpipeline1:armhf (1.4.1-2) ...
Setting up m4 (1.4.18-1) ...
Setting up libicu57:armhf (57.1-5) ...
Setting up libbsd0:armhf (0.8.3-1) ...
Setting up libxml2:armhf (2.9.4+dfsg1-2.1) ...
Setting up libmagic-mgc (1:5.29-2) ...
Setting up libmagic1:armhf (1:5.29-2) ...
Setting up libssl1.0.2:armhf (1.0.2j-5) ...
Setting up ruby-did-you-mean (1.0.0-2) ...
Setting up libyaml-0-2:armhf (0.1.7-2) ...
Processing triggers for libc-bin (2.24-7+rpi1) ...
Setting up autotools-dev (20161112.1) ...
Setting up libunistring0:armhf (0.9.6+really0.9.3-0.1) ...
Setting up libssl1.1:armhf (1.1.0c-2) ...
Processing triggers for systemd (232-6) ...
Setting up openssl (1.1.0c-2) ...
Setting up ruby-net-telnet (0.1.1-2) ...
Setting up libffi6:armhf (3.2.1-6) ...
Setting up libmarkdown2:armhf (2.2.1-1) ...
Setting up libxdmcp6:armhf (1:1.1.2-1.1) ...
Setting up bsdmainutils (9.0.12) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up ruby-minitest (5.9.0-1) ...
Setting up x11-common (1:7.7+18) ...
update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
Running in chroot, ignoring request.
All runlevel operations denied by policy
invoke-rc.d: policy-rc.d denied execution of start.
Setting up ca-certificates (20161130) ...
Updating certificates in /etc/ssl/certs...
173 added, 0 removed; done.
Setting up libx11-data (2:1.6.4-2) ...
Setting up libpython2.7-stdlib:armhf (2.7.13-1) ...
Setting up libxau6:armhf (1:1.0.8-1) ...
Setting up autopoint (0.19.8.1-1) ...
Setting up ruby-power-assert (0.3.0-1) ...
Setting up zlib1g-dev:armhf (1:1.2.8.dfsg-4) ...
Setting up libfile-stripnondeterminism-perl (0.029-2) ...
Setting up ruby-test-unit (3.1.7-2) ...
Setting up libglib2.0-0:armhf (2.50.2-2) ...
No schema files found: doing nothing.
Setting up python2.7 (2.7.13-1) ...
Setting up autoconf (2.69-10) ...
Setting up file (1:5.29-2) ...
Setting up libcroco3:armhf (0.6.11-2) ...
Setting up libpython-stdlib:armhf (2.7.13-1) ...
Setting up automake (1:1.15-5) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Setting up libice6:armhf (2:1.0.9-1+b1) ...
Setting up rubygems-integration (1.11) ...
Setting up man-db (2.7.6.1-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libxcb1:armhf (1.12-1) ...
Setting up python (2.7.13-1) ...
Setting up python-markdown (2.6.7-1) ...
Setting up libtool (2.4.6-2) ...
Setting up libsm6:armhf (2:1.2.2-1+b1) ...
Setting up gettext (0.19.8.1-1) ...
Setting up libx11-6:armhf (2:1.6.4-2) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up libxpm4:armhf (1:3.5.12-1) ...
Setting up libxt6:armhf (1:1.1.5-1) ...
Setting up libxext6:armhf (2:1.3.3-1) ...
Setting up po-debconf (1.0.20) ...
Setting up libxmu6:armhf (2:1.1.2-2) ...
Setting up libxaw7:armhf (2:1.0.13-1) ...
Setting up groff (1.22.3-9) ...
Setting up dh-autoreconf (13) ...
Setting up rake (10.5.0-2) ...
Setting up dh-strip-nondeterminism (0.029-2) ...
Setting up libruby2.3:armhf (2.3.3-1) ...
Setting up debhelper (10.2.3) ...
Setting up ruby2.3 (2.3.3-1) ...
Setting up ruby (1:2.3.3) ...
Setting up ruby-rdiscount (2.1.8-1+b1) ...
Setting up ruby-mustache (1.0.2-1) ...
Setting up ruby-fast-xs (0.8.0-3+b4) ...
Setting up ruby-hpricot (0.8.6-6+b1) ...
Setting up ruby-ronn (0.7.3-5) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.24-7+rpi1) ...
Processing triggers for systemd (232-6) ...
Processing triggers for ca-certificates (20161130) ...
Updating certificates in /etc/ssl/certs...
0 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 4.4.0-1-armmp armhf (armv7l)
Toolchain package versions: binutils_2.27.51.20161127-1 dpkg-dev_1.18.15 g++-6_6.2.1-5+rpi1 gcc-6_6.2.1-5+rpi1 libc6-dev_2.24-7+rpi1 libstdc++-6-dev_6.2.1-5+rpi1 libstdc++6_6.2.1-5+rpi1 linux-libc-dev_3.18.5-1~exp1+rpi19+stretch
Package versions: adduser_3.115 apt_1.4~beta1 autoconf_2.69-10 automake_1:1.15-5 autopoint_0.19.8.1-1 autotools-dev_20161112.1 base-files_9.7+rpi1 base-passwd_3.5.41 bash_4.4-2 binutils_2.27.51.20161127-1 bsdmainutils_9.0.12 bsdutils_1:2.29-1 build-essential_12.2 bzip2_1.0.6-8 ca-certificates_20161130 coreutils_8.25-2 cpio_2.11+dfsg-6 cpp_4:6.1.1-1 cpp-6_6.2.1-5+rpi1 dash_0.5.8-2.3 debconf_1.5.59 debfoster_2.7-2.1 debhelper_10.2.3 debianutils_4.8.1 dh-autoreconf_13 dh-strip-nondeterminism_0.029-2 diffutils_1:3.5-1 dmsetup_2:1.02.136-1 dpkg_1.18.15 dpkg-dev_1.18.15 e2fslibs_1.43.3-1 e2fsprogs_1.43.3-1 fakeroot_1.21-2 file_1:5.29-2 findutils_4.6.0+git+20161106-1 fuse2fs_1.43.3-1 g++_4:6.1.1-1 g++-6_6.2.1-5+rpi1 gcc_4:6.1.1-1 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-11+rpi1 gcc-4.8-base_4.8.5-4 gcc-4.9-base_4.9.3-14 gcc-6_6.2.1-5+rpi1 gcc-6-base_6.2.1-5+rpi1 gettext_0.19.8.1-1 gettext-base_0.19.8.1-1 gnupg_2.1.16-2 gnupg-agent_2.1.16-2 gnupg-l10n_2.1.16-2 gpgv_2.1.16-2 grep_2.26-1 groff_1.22.3-9 groff-base_1.22.3-9 gzip_1.6-5 hostname_3.18 init_1.46 init-system-helpers_1.46 initscripts_2.88dsf-59.8 insserv_1.14.0-5.4 intltool-debian_0.35.0+20060710.4 kbd_2.0.3-2 klibc-utils_2.0.4-9+rpi1 kmod_23-1 libacl1_2.2.52-3 libapparmor1_2.10.95-6 libapt-pkg5.0_1.4~beta1 libarchive-zip-perl_1.59-1 libasan3_6.2.1-5+rpi1 libassuan0_2.4.3-2 libatomic1_6.2.1-5+rpi1 libattr1_1:2.4.47-2 libaudit-common_1:2.6.7-1 libaudit1_1:2.6.7-1 libblkid1_2.29-1 libbsd0_0.8.3-1 libbz2-1.0_1.0.6-8 libc-bin_2.24-7+rpi1 libc-dev-bin_2.24-7+rpi1 libc6_2.24-7+rpi1 libc6-dev_2.24-7+rpi1 libcap-ng0_0.7.7-3 libcap2_1:2.25-1 libcap2-bin_1:2.25-1 libcc1-0_6.2.1-5+rpi1 libcomerr2_1.43.3-1 libcroco3_0.6.11-2 libcryptsetup4_2:1.7.3-2 libdb5.3_5.3.28-12 libdbus-1-3_1.10.14-1 libdebconfclient0_0.218 libdevmapper1.02.1_2:1.02.136-1 libdpkg-perl_1.18.15 libdrm2_2.4.74-1 libexpat1_2.2.0-2 libfakeroot_1.21-2 libfdisk1_2.29-1 libffi6_3.2.1-6 libfile-stripnondeterminism-perl_0.029-2 libfuse2_2.9.7-1 libgc1c2_1:7.4.2-8 libgcc-6-dev_6.2.1-5+rpi1 libgcc1_1:6.2.1-5+rpi1 libgcrypt20_1.7.3-2 libgdbm3_1.8.3-14 libglib2.0-0_2.50.2-2 libgmp10_2:6.1.1+dfsg-1 libgomp1_6.2.1-5+rpi1 libgpg-error0_1.25-1 libice6_2:1.0.9-1+b1 libicu57_57.1-5 libidn11_1.33-1 libip4tc0_1.6.0-4 libisl15_0.17.1-1 libklibc_2.0.4-9+rpi1 libkmod2_23-1 libksba8_1.3.5-2 liblz4-1_0.0~r131-2 liblzma5_5.2.2-1.2 libmagic-mgc_1:5.29-2 libmagic1_1:5.29-2 libmarkdown2_2.2.1-1 libmount1_2.29-1 libmpc3_1.0.3-1 libmpfr4_3.1.5-1 libncurses5_6.0+20160917-1 libncursesw5_6.0+20160917-1 libnpth0_1.3-1 libpam-modules_1.1.8-3.3 libpam-modules-bin_1.1.8-3.3 libpam-runtime_1.1.8-3.3 libpam0g_1.1.8-3.3 libpcre3_2:8.39-2 libperl5.24_5.24.1~rc4-1 libpipeline1_1.4.1-2 libplymouth4_0.9.2-3 libpng12-0_1.2.54-6 libprocps6_2:3.3.12-3 libpython-stdlib_2.7.13-1 libpython2.7-minimal_2.7.13-1 libpython2.7-stdlib_2.7.13-1 libreadline7_7.0-1 libruby2.3_2.3.3-1 libseccomp2_2.3.1-2.1 libselinux1_2.6-3 libsemanage-common_2.6-1 libsemanage1_2.6-1 libsepol1_2.6-1 libsigsegv2_2.10-5 libsm6_2:1.2.2-1+b1 libsmartcols1_2.29-1 libsqlite3-0_3.15.2-1 libss2_1.43.3-1 libssl1.0.2_1.0.2j-5 libssl1.1_1.1.0c-2 libstdc++-6-dev_6.2.1-5+rpi1 libstdc++6_6.2.1-5+rpi1 libsystemd0_232-6 libtimedate-perl_2.3000-2 libtinfo5_6.0+20160917-1 libtool_2.4.6-2 libubsan0_6.2.1-5+rpi1 libudev1_232-6 libunistring0_0.9.6+really0.9.3-0.1 libusb-0.1-4_2:0.1.12-30 libustr-1.0-1_1.0.4-6 libuuid1_2.29-1 libx11-6_2:1.6.4-2 libx11-data_2:1.6.4-2 libxau6_1:1.0.8-1 libxaw7_2:1.0.13-1 libxcb1_1.12-1 libxdmcp6_1:1.1.2-1.1 libxext6_2:1.3.3-1 libxml2_2.9.4+dfsg1-2.1 libxmu6_2:1.1.2-2 libxpm4_1:3.5.12-1 libxt6_1:1.1.5-1 libyaml-0-2_0.1.7-2 linux-libc-dev_3.18.5-1~exp1+rpi19+stretch login_1:4.2-3.3 lsb-base_9.20161125+rpi1 m4_1.4.18-1 make_4.1-9 makedev_2.3.1-93 man-db_2.7.6.1-2 manpages_4.08-1 mawk_1.3.3-17 mime-support_3.60 mount_2.29-1 multiarch-support_2.24-7+rpi1 ncurses-base_6.0+20160917-1 ncurses-bin_6.0+20160917-1 netbase_5.3 openssl_1.1.0c-2 passwd_1:4.2-3.3 patch_2.7.5-1 perl_5.24.1~rc4-1 perl-base_5.24.1~rc4-1 perl-modules-5.24_5.24.1~rc4-1 pinentry-curses_0.9.7-9 po-debconf_1.0.20 procps_2:3.3.12-3 psmisc_22.21-2.1 python_2.7.13-1 python-markdown_2.6.7-1 python-minimal_2.7.13-1 python2.7_2.7.13-1 python2.7-minimal_2.7.13-1 rake_10.5.0-2 raspbian-archive-keyring_20120528.2 readline-common_7.0-1 ruby_1:2.3.3 ruby-did-you-mean_1.0.0-2 ruby-fast-xs_0.8.0-3+b4 ruby-hpricot_0.8.6-6+b1 ruby-minitest_5.9.0-1 ruby-mustache_1.0.2-1 ruby-net-telnet_0.1.1-2 ruby-power-assert_0.3.0-1 ruby-rdiscount_2.1.8-1+b1 ruby-ronn_0.7.3-5 ruby-test-unit_3.1.7-2 ruby2.3_2.3.3-1 rubygems-integration_1.11 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.2.2-8 sensible-utils_0.0.9 startpar_0.59-3.1 systemd_232-6 systemd-sysv_232-6 sysv-rc_2.88dsf-59.8 sysvinit-utils_2.88dsf-59.8 tar_1.29b-1.1 tzdata_2016j-2 udev_232-6 util-linux_2.29-1 x11-common_1:7.7+18 xz-utils_5.2.2-1.2 zlib1g_1:1.2.8.dfsg-4 zlib1g-dev_1:1.2.8.dfsg-4
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/sbuild-nonexistent/.gnupg/trustedkeys.kbx': General error
gpgv: Signature made Tue Jan 17 17:27:28 2017 UTC
gpgv: using RSA key 578A0494D1C646D1
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-1.dsc
dpkg-source: info: extracting seqprep in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.3.2-1.debian.tar.xz
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
Check disc space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=stretch-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=stretch-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=stretch-staging-armhf-sbuild-49509c06-0003-4f72-ae33-07c57ef700a0
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=linux
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: info: source package seqprep
dpkg-buildpackage: info: source version 1.3.2-1
dpkg-buildpackage: info: source distribution unstable
dpkg-source --before-build seqprep-1.3.2
dpkg-buildpackage: info: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_testdir
dh_auto_clean
make -j4 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
rm -f SeqPrep.o utils.o stdaln.o SeqPrep
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_autoreconf_clean
debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean
rm -f seqprep
rm -f debian/*.1
rm -f README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules build-arch
dh build-arch
dh_testdir -a
dh_update_autotools_config -a
dh_autoreconf -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build
make -j4
make[2]: Entering directory '/<<PKGBUILDDIR>>'
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o
cc -g -O2 -fdebug-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o
SeqPrep.c: In function 'main':
SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration]
while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) {
^~~~~~
cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
cp SeqPrep seqprep
TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn
roff: debian/seqprep.1
markdown_py -f README.html README.md
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.994231
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 0
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.870431
++ prog=gzcat
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j4 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
Makefile:15: recipe for target 'install' failed
make[1]: [install] Error 1 (ignored)
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_strip_nondeterminism -a
dh_compress -a
dh_fixperms -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dpkg-shlibdeps: warning: package could avoid a useless dependency if debian/seqprep/usr/bin/seqprep was not linked against ld-linux-armhf.so.3 (it uses none of the library's symbols)
dh_installdeb -a
dh_gencontrol -a
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-1_armhf.deb'.
dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-1_armhf.deb'.
dpkg-genbuildinfo --build=any
dpkg-genbuildinfo: warning: File::FcntlLock not available; using flock which is not NFS-safe
dpkg-genchanges --build=any -mRaspbian wandboard test autobuilder <root@raspbian.org> >../seqprep_1.3.2-1_armhf.changes
dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build seqprep-1.3.2
dpkg-buildpackage: info: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 2017-01-28T06:16:19Z
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
seqprep_1.3.2-1_armhf.changes:
------------------------------
Format: 1.8
Date: Tue, 17 Jan 2017 18:24:59 +0100
Source: seqprep
Binary: seqprep seqprep-data
Architecture: armhf
Version: 1.3.2-1
Distribution: stretch-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
seqprep-data - example data set for seqprep - only used for testing
Changes:
seqprep (1.3.2-1) unstable; urgency=medium
.
* New upstream version
* debhelper 10
* d/watch: version=4
Checksums-Sha1:
1197d7706bb7b2be94225755ac2b9631f7013921 16258 seqprep-dbgsym_1.3.2-1_armhf.deb
b79601da7b892715bd7cf97513122da834d101f9 5703 seqprep_1.3.2-1_armhf.buildinfo
482e8425aa512e269fb27b78ce7a61ccaf1e7ca0 26854 seqprep_1.3.2-1_armhf.deb
Checksums-Sha256:
d21b7053c30454ba3bfb73b9cf438e0970645da73804379da207abb4dd2fe5a1 16258 seqprep-dbgsym_1.3.2-1_armhf.deb
678afded0ce32bfb403f23a76283178968ff8b63aab093e8dd1d84cf86373bae 5703 seqprep_1.3.2-1_armhf.buildinfo
13b225d24b64c40239d9670b043e915f3378e0f7e0966053a830227c22d04f5d 26854 seqprep_1.3.2-1_armhf.deb
Files:
e1e0018f65fcb4e9551ca8ad3913a126 16258 debug extra seqprep-dbgsym_1.3.2-1_armhf.deb
aa2b671b1ea949f97764043740b47f50 5703 science optional seqprep_1.3.2-1_armhf.buildinfo
c11e43950e5c97e30155460862665c71 26854 science optional seqprep_1.3.2-1_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
seqprep-dbgsym_1.3.2-1_armhf.deb
--------------------------------
new debian package, version 2.0.
size 16258 bytes: control archive=489 bytes.
411 bytes, 13 lines control
106 bytes, 1 lines md5sums
Package: seqprep-dbgsym
Source: seqprep
Version: 1.3.2-1
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 32
Depends: seqprep (= 1.3.2-1)
Section: debug
Priority: extra
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: Debug symbols for seqprep
Auto-Built-Package: debug-symbols
Build-Ids: 92749d89d3423c03817d68975efa2448eead8f91
drwxr-xr-x root/root 0 2017-01-17 17:24 ./
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/lib/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/lib/debug/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/lib/debug/.build-id/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/lib/debug/.build-id/92/
-rw-r--r-- root/root 21664 2017-01-17 17:24 ./usr/lib/debug/.build-id/92/749d89d3423c03817d68975efa2448eead8f91.debug
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/doc/
lrwxrwxrwx root/root 0 2017-01-17 17:24 ./usr/share/doc/seqprep-dbgsym -> seqprep
seqprep_1.3.2-1_armhf.deb
-------------------------
new debian package, version 2.0.
size 26854 bytes: control archive=1017 bytes.
1172 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.3.2-1
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 122
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2017-01-17 17:24 ./
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/bin/
-rwxr-xr-x root/root 94696 2017-01-17 17:24 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/doc/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11749 2017-01-17 17:24 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 848 2017-01-17 17:24 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1439 2017-01-17 17:24 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/man/
drwxr-xr-x root/root 0 2017-01-17 17:24 ./usr/share/man/man1/
-rw-r--r-- root/root 4568 2017-01-17 17:24 ./usr/share/man/man1/seqprep.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 65036
Build-Time: 274
Distribution: stretch-staging
Host Architecture: armhf
Install-Time: 413
Job: seqprep_1.3.2-1
Machine Architecture: armhf
Package: seqprep
Package-Time: 755
Source-Version: 1.3.2-1
Space: 65036
Status: successful
Version: 1.3.2-1
--------------------------------------------------------------------------------
Finished at 2017-01-28T06:16:19Z
Build needed 00:12:35, 65036k disc space