seqprep →
1.2-1 →
armhf → 2016-05-04 11:39:00
sbuild (Debian sbuild) 0.66.0 (04 Oct 2015) on bm-wb-02
+==============================================================================+
| seqprep 1.2-1 (armhf) 04 May 2016 11:24 |
+==============================================================================+
Package: seqprep
Version: 1.2-1
Source Version: 1.2-1
Distribution: stretch-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'build/seqprep-eBUJ7U/seqprep-1.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/seqprep-eBUJ7U' with '<<BUILDDIR>>'
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/stretch-staging-armhf-sbuild-67e846a1-46e3-4ebc-bf7b-6531717edfeb' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private stretch-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private stretch-staging/main Sources [8944 kB]
Get:3 http://172.17.0.1/private stretch-staging/main armhf Packages [11.0 MB]
Fetched 20.0 MB in 21s (932 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'seqprep' packaging is maintained in the 'Svn' version control system at:
svn://anonscm.debian.org/debian-med/trunk/packages/seqprep/trunk/
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private stretch-staging/main seqprep 1.2-1 (dsc) [2084 B]
Get:2 http://172.17.0.1/private stretch-staging/main seqprep 1.2-1 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private stretch-staging/main seqprep 1.2-1 (diff) [9280 B]
Fetched 37.2 MB in 3s (10.8 MB/s)
Download complete and in download only mode
Check architectures
-------------------
Check dependencies
------------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-16kAps/apt_archive/sbuild-build-depends-core-dummy.deb'.
OK
Get:1 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ InRelease
Ign:1 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ InRelease
Get:2 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Release [2119 B]
Get:2 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Release [2119 B]
Get:3 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Release.gpg [299 B]
Get:3 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Release.gpg [299 B]
Get:4 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Sources [194 B]
Get:5 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ Packages [508 B]
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
W: file:///<<BUILDDIR>>/resolver-16kAps/apt_archive/./Release.gpg: Signature by key 3493EC2B8E6DC280C121C60435506D9A48F77B2E uses weak digest algorithm (SHA1)
Reading package lists...
+------------------------------------------------------------------------------+
| Install core build dependencies (apt-based resolver) |
+------------------------------------------------------------------------------+
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 44 not upgraded.
Need to get 0 B/768 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 file:/<<BUILDDIR>>/resolver-16kAps/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [768 B]
debconf: delaying package configuration, since apt-utils is not installed
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 13579 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
Merged Build-Depends: debhelper (>= 9), python, python-markdown, ruby-ronn, zlib1g-dev
Filtered Build-Depends: debhelper (>= 9), python, python-markdown, ruby-ronn, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
OK
Get:1 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ InRelease
Ign:1 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ InRelease
Get:2 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Release [2119 B]
Get:2 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Release [2119 B]
Get:3 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Release.gpg [299 B]
Get:3 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Release.gpg [299 B]
Get:4 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Sources [220 B]
Get:5 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ Packages [538 B]
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
W: file:///<<BUILDDIR>>/resolver-rwt_Sb/apt_archive/./Release.gpg: Signature by key 3493EC2B8E6DC280C121C60435506D9A48F77B2E uses weak digest algorithm (SHA1)
Reading package lists...
+------------------------------------------------------------------------------+
| Install seqprep build dependencies (apt-based resolver) |
+------------------------------------------------------------------------------+
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libffi6 libfile-stripnondeterminism-perl libglib2.0-0 libice6
libicu55 libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libsqlite3-0 libssl1.0.2 libtool libunistring0 libx11-6 libx11-data libxau6
libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6
libyaml-0-2 m4 man-db mime-support openssl po-debconf python python-markdown
python-minimal python2.7 python2.7-minimal rake ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.3
rubygems-integration x11-common zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
vacation dh-make gettext-doc libasprintf-dev libgettextpo-dev libtool-doc
gfortran | fortran95-compiler gcj-jdk less www-browser libmail-box-perl
python-doc python-tk python-markdown-doc python2.7-doc binfmt-support ri
ruby-dev bundler
Recommended packages:
curl | wget | lynx-cur ghostscript imagemagick libpaper1 netpbm psutils
libglib2.0-data shared-mime-info xdg-user-dirs libltdl-dev xml-core
libmail-sendmail-perl python-pygments python-yaml zip fonts-lato
libjs-jquery
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdmainutils ca-certificates
debhelper dh-autoreconf dh-strip-nondeterminism file gettext gettext-base
groff groff-base intltool-debian libarchive-zip-perl libbsd0 libcroco3
libexpat1 libffi6 libfile-stripnondeterminism-perl libglib2.0-0 libice6
libicu55 libmagic1 libmarkdown2 libpipeline1 libpython-stdlib
libpython2.7-minimal libpython2.7-stdlib libruby2.3 libsigsegv2 libsm6
libsqlite3-0 libssl1.0.2 libtool libunistring0 libx11-6 libx11-data libxau6
libxaw7 libxcb1 libxdmcp6 libxext6 libxml2 libxmu6 libxpm4 libxt6
libyaml-0-2 m4 man-db mime-support openssl po-debconf python python-markdown
python-minimal python2.7 python2.7-minimal rake ruby ruby-did-you-mean
ruby-fast-xs ruby-hpricot ruby-minitest ruby-mustache ruby-net-telnet
ruby-power-assert ruby-rdiscount ruby-ronn ruby-test-unit ruby2.3
rubygems-integration sbuild-build-depends-seqprep-dummy x11-common
zlib1g-dev
0 upgraded, 76 newly installed, 0 to remove and 44 not upgraded.
Need to get 33.3 MB/33.3 MB of archives.
After this operation, 115 MB of additional disk space will be used.
Get:1 file:/<<BUILDDIR>>/resolver-rwt_Sb/apt_archive ./ sbuild-build-depends-seqprep-dummy 0.invalid.0 [800 B]
Get:2 http://172.17.0.1/private stretch-staging/main armhf groff-base armhf 1.22.3-7 [1083 kB]
Get:3 http://172.17.0.1/private stretch-staging/main armhf libbsd0 armhf 0.8.3-1 [89.0 kB]
Get:4 http://172.17.0.1/private stretch-staging/main armhf bsdmainutils armhf 9.0.10 [177 kB]
Get:5 http://172.17.0.1/private stretch-staging/main armhf libpipeline1 armhf 1.4.1-2 [23.7 kB]
Get:6 http://172.17.0.1/private stretch-staging/main armhf man-db armhf 2.7.5-1 [975 kB]
Get:7 http://172.17.0.1/private stretch-staging/main armhf libpython2.7-minimal armhf 2.7.11-8 [381 kB]
Get:8 http://172.17.0.1/private stretch-staging/main armhf python2.7-minimal armhf 2.7.11-8 [1161 kB]
Get:9 http://172.17.0.1/private stretch-staging/main armhf python-minimal armhf 2.7.11-1 [40.0 kB]
Get:10 http://172.17.0.1/private stretch-staging/main armhf mime-support all 3.59 [36.4 kB]
Get:11 http://172.17.0.1/private stretch-staging/main armhf libexpat1 armhf 2.1.1-1 [60.4 kB]
Get:12 http://172.17.0.1/private stretch-staging/main armhf libffi6 armhf 3.2.1-4 [18.5 kB]
Get:13 http://172.17.0.1/private stretch-staging/main armhf libsqlite3-0 armhf 3.12.2-1 [464 kB]
Get:14 http://172.17.0.1/private stretch-staging/main armhf libssl1.0.2 armhf 1.0.2g-2 [886 kB]
Get:15 http://172.17.0.1/private stretch-staging/main armhf libpython2.7-stdlib armhf 2.7.11-8 [1818 kB]
Get:16 http://172.17.0.1/private stretch-staging/main armhf python2.7 armhf 2.7.11-8 [269 kB]
Get:17 http://172.17.0.1/private stretch-staging/main armhf libpython-stdlib armhf 2.7.11-1 [19.5 kB]
Get:18 http://172.17.0.1/private stretch-staging/main armhf python armhf 2.7.11-1 [150 kB]
Get:19 http://172.17.0.1/private stretch-staging/main armhf libmarkdown2 armhf 2.1.8-2 [27.7 kB]
Get:20 http://172.17.0.1/private stretch-staging/main armhf libunistring0 armhf 0.9.3-5.2 [253 kB]
Get:21 http://172.17.0.1/private stretch-staging/main armhf libxau6 armhf 1:1.0.8-1 [19.9 kB]
Get:22 http://172.17.0.1/private stretch-staging/main armhf libxdmcp6 armhf 1:1.1.2-1.1 [24.9 kB]
Get:23 http://172.17.0.1/private stretch-staging/main armhf libxcb1 armhf 1.11.1-1 [40.9 kB]
Get:24 http://172.17.0.1/private stretch-staging/main armhf libx11-data all 2:1.6.3-1 [128 kB]
Get:25 http://172.17.0.1/private stretch-staging/main armhf libx11-6 armhf 2:1.6.3-1 [678 kB]
Get:26 http://172.17.0.1/private stretch-staging/main armhf libxext6 armhf 2:1.3.3-1 [48.1 kB]
Get:27 http://172.17.0.1/private stretch-staging/main armhf libyaml-0-2 armhf 0.1.6-3 [41.5 kB]
Get:28 http://172.17.0.1/private stretch-staging/main armhf libmagic1 armhf 1:5.25-2 [250 kB]
Get:29 http://172.17.0.1/private stretch-staging/main armhf file armhf 1:5.25-2 [61.2 kB]
Get:30 http://172.17.0.1/private stretch-staging/main armhf gettext-base armhf 0.19.7-2 [111 kB]
Get:31 http://172.17.0.1/private stretch-staging/main armhf libicu55 armhf 55.1-7 [7380 kB]
Get:32 http://172.17.0.1/private stretch-staging/main armhf libxml2 armhf 2.9.3+dfsg1-1 [800 kB]
Get:33 http://172.17.0.1/private stretch-staging/main armhf libsigsegv2 armhf 2.10-5 [28.4 kB]
Get:34 http://172.17.0.1/private stretch-staging/main armhf m4 armhf 1.4.17-5 [239 kB]
Get:35 http://172.17.0.1/private stretch-staging/main armhf autoconf all 2.69-10 [338 kB]
Get:36 http://172.17.0.1/private stretch-staging/main armhf autotools-dev all 20150820.1 [71.7 kB]
Get:37 http://172.17.0.1/private stretch-staging/main armhf automake all 1:1.15-4 [735 kB]
Get:38 http://172.17.0.1/private stretch-staging/main armhf autopoint all 0.19.7-2 [424 kB]
Get:39 http://172.17.0.1/private stretch-staging/main armhf openssl armhf 1.0.2g-2 [666 kB]
Get:40 http://172.17.0.1/private stretch-staging/main armhf ca-certificates all 20160104 [200 kB]
Get:41 http://172.17.0.1/private stretch-staging/main armhf libglib2.0-0 armhf 2.48.0-1 [2540 kB]
Get:42 http://172.17.0.1/private stretch-staging/main armhf libcroco3 armhf 0.6.11-1 [131 kB]
Get:43 http://172.17.0.1/private stretch-staging/main armhf gettext armhf 0.19.7-2 [1400 kB]
Get:44 http://172.17.0.1/private stretch-staging/main armhf intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:45 http://172.17.0.1/private stretch-staging/main armhf po-debconf all 1.0.19 [249 kB]
Get:46 http://172.17.0.1/private stretch-staging/main armhf libarchive-zip-perl all 1.57-1 [95.1 kB]
Get:47 http://172.17.0.1/private stretch-staging/main armhf libfile-stripnondeterminism-perl all 0.016-1 [11.9 kB]
Get:48 http://172.17.0.1/private stretch-staging/main armhf dh-strip-nondeterminism all 0.016-1 [6998 B]
Get:49 http://172.17.0.1/private stretch-staging/main armhf libtool all 2.4.6-0.1 [200 kB]
Get:50 http://172.17.0.1/private stretch-staging/main armhf dh-autoreconf all 12 [15.8 kB]
Get:51 http://172.17.0.1/private stretch-staging/main armhf debhelper all 9.20160403 [800 kB]
Get:52 http://172.17.0.1/private stretch-staging/main armhf x11-common all 1:7.7+15 [251 kB]
Get:53 http://172.17.0.1/private stretch-staging/main armhf libice6 armhf 2:1.0.9-1+b1 [51.9 kB]
Get:54 http://172.17.0.1/private stretch-staging/main armhf libsm6 armhf 2:1.2.2-1+b1 [31.2 kB]
Get:55 http://172.17.0.1/private stretch-staging/main armhf libxt6 armhf 1:1.1.5-1 [155 kB]
Get:56 http://172.17.0.1/private stretch-staging/main armhf libxmu6 armhf 2:1.1.2-2 [52.0 kB]
Get:57 http://172.17.0.1/private stretch-staging/main armhf libxpm4 armhf 1:3.5.11-1+b1 [42.4 kB]
Get:58 http://172.17.0.1/private stretch-staging/main armhf libxaw7 armhf 2:1.0.13-1 [164 kB]
Get:59 http://172.17.0.1/private stretch-staging/main armhf groff armhf 1.22.3-7 [3225 kB]
Get:60 http://172.17.0.1/private stretch-staging/main armhf python-markdown all 2.6.6-1 [56.2 kB]
Get:61 http://172.17.0.1/private stretch-staging/main armhf rubygems-integration all 1.10 [4882 B]
Get:62 http://172.17.0.1/private stretch-staging/main armhf ruby-did-you-mean all 1.0.0-2 [11.2 kB]
Get:63 http://172.17.0.1/private stretch-staging/main armhf ruby-minitest all 5.8.4-2 [50.3 kB]
Get:64 http://172.17.0.1/private stretch-staging/main armhf ruby-net-telnet all 0.1.1-2 [12.5 kB]
Get:65 http://172.17.0.1/private stretch-staging/main armhf ruby-power-assert all 0.2.7-1 [7578 B]
Get:66 http://172.17.0.1/private stretch-staging/main armhf ruby-test-unit all 3.1.7-2 [69.6 kB]
Get:67 http://172.17.0.1/private stretch-staging/main armhf libruby2.3 armhf 2.3.1-1 [2846 kB]
Get:68 http://172.17.0.1/private stretch-staging/main armhf ruby2.3 armhf 2.3.1-1 [177 kB]
Get:69 http://172.17.0.1/private stretch-staging/main armhf ruby armhf 1:2.3.0+4 [10.6 kB]
Get:70 http://172.17.0.1/private stretch-staging/main armhf rake all 10.5.0-2 [49.4 kB]
Get:71 http://172.17.0.1/private stretch-staging/main armhf ruby-fast-xs armhf 0.8.0-3+b4 [8562 B]
Get:72 http://172.17.0.1/private stretch-staging/main armhf ruby-hpricot armhf 0.8.6-6+b1 [66.0 kB]
Get:73 http://172.17.0.1/private stretch-staging/main armhf ruby-mustache all 1.0.2-1 [25.1 kB]
Get:74 http://172.17.0.1/private stretch-staging/main armhf ruby-rdiscount armhf 2.1.8-1+b1 [32.9 kB]
Get:75 http://172.17.0.1/private stretch-staging/main armhf ruby-ronn all 0.7.3-4 [29.6 kB]
Get:76 http://172.17.0.1/private stretch-staging/main armhf zlib1g-dev armhf 1:1.2.8.dfsg-2+b1 [197 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 33.3 MB in 3s (9511 kB/s)
Selecting previously unselected package groff-base.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 13579 files and directories currently installed.)
Preparing to unpack .../groff-base_1.22.3-7_armhf.deb ...
Unpacking groff-base (1.22.3-7) ...
Selecting previously unselected package libbsd0:armhf.
Preparing to unpack .../libbsd0_0.8.3-1_armhf.deb ...
Unpacking libbsd0:armhf (0.8.3-1) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../bsdmainutils_9.0.10_armhf.deb ...
Unpacking bsdmainutils (9.0.10) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../libpipeline1_1.4.1-2_armhf.deb ...
Unpacking libpipeline1:armhf (1.4.1-2) ...
Selecting previously unselected package man-db.
Preparing to unpack .../man-db_2.7.5-1_armhf.deb ...
Unpacking man-db (2.7.5-1) ...
Selecting previously unselected package libpython2.7-minimal:armhf.
Preparing to unpack .../libpython2.7-minimal_2.7.11-8_armhf.deb ...
Unpacking libpython2.7-minimal:armhf (2.7.11-8) ...
Selecting previously unselected package python2.7-minimal.
Preparing to unpack .../python2.7-minimal_2.7.11-8_armhf.deb ...
Unpacking python2.7-minimal (2.7.11-8) ...
Selecting previously unselected package python-minimal.
Preparing to unpack .../python-minimal_2.7.11-1_armhf.deb ...
Unpacking python-minimal (2.7.11-1) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../mime-support_3.59_all.deb ...
Unpacking mime-support (3.59) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../libexpat1_2.1.1-1_armhf.deb ...
Unpacking libexpat1:armhf (2.1.1-1) ...
Selecting previously unselected package libffi6:armhf.
Preparing to unpack .../libffi6_3.2.1-4_armhf.deb ...
Unpacking libffi6:armhf (3.2.1-4) ...
Selecting previously unselected package libsqlite3-0:armhf.
Preparing to unpack .../libsqlite3-0_3.12.2-1_armhf.deb ...
Unpacking libsqlite3-0:armhf (3.12.2-1) ...
Selecting previously unselected package libssl1.0.2:armhf.
Preparing to unpack .../libssl1.0.2_1.0.2g-2_armhf.deb ...
Unpacking libssl1.0.2:armhf (1.0.2g-2) ...
Selecting previously unselected package libpython2.7-stdlib:armhf.
Preparing to unpack .../libpython2.7-stdlib_2.7.11-8_armhf.deb ...
Unpacking libpython2.7-stdlib:armhf (2.7.11-8) ...
Selecting previously unselected package python2.7.
Preparing to unpack .../python2.7_2.7.11-8_armhf.deb ...
Unpacking python2.7 (2.7.11-8) ...
Selecting previously unselected package libpython-stdlib:armhf.
Preparing to unpack .../libpython-stdlib_2.7.11-1_armhf.deb ...
Unpacking libpython-stdlib:armhf (2.7.11-1) ...
Processing triggers for libc-bin (2.22-5) ...
Setting up libpython2.7-minimal:armhf (2.7.11-8) ...
Setting up python2.7-minimal (2.7.11-8) ...
Setting up python-minimal (2.7.11-1) ...
Selecting previously unselected package python.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 14948 files and directories currently installed.)
Preparing to unpack .../python_2.7.11-1_armhf.deb ...
Unpacking python (2.7.11-1) ...
Selecting previously unselected package libmarkdown2:armhf.
Preparing to unpack .../libmarkdown2_2.1.8-2_armhf.deb ...
Unpacking libmarkdown2:armhf (2.1.8-2) ...
Selecting previously unselected package libunistring0:armhf.
Preparing to unpack .../libunistring0_0.9.3-5.2_armhf.deb ...
Unpacking libunistring0:armhf (0.9.3-5.2) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../libxau6_1%3a1.0.8-1_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.8-1) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../libxdmcp6_1%3a1.1.2-1.1_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-1.1) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../libxcb1_1.11.1-1_armhf.deb ...
Unpacking libxcb1:armhf (1.11.1-1) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../libx11-data_2%3a1.6.3-1_all.deb ...
Unpacking libx11-data (2:1.6.3-1) ...
Selecting previously unselected package libx11-6:armhf.
Preparing to unpack .../libx11-6_2%3a1.6.3-1_armhf.deb ...
Unpacking libx11-6:armhf (2:1.6.3-1) ...
Selecting previously unselected package libxext6:armhf.
Preparing to unpack .../libxext6_2%3a1.3.3-1_armhf.deb ...
Unpacking libxext6:armhf (2:1.3.3-1) ...
Selecting previously unselected package libyaml-0-2:armhf.
Preparing to unpack .../libyaml-0-2_0.1.6-3_armhf.deb ...
Unpacking libyaml-0-2:armhf (0.1.6-3) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../libmagic1_1%3a5.25-2_armhf.deb ...
Unpacking libmagic1:armhf (1:5.25-2) ...
Selecting previously unselected package file.
Preparing to unpack .../file_1%3a5.25-2_armhf.deb ...
Unpacking file (1:5.25-2) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../gettext-base_0.19.7-2_armhf.deb ...
Unpacking gettext-base (0.19.7-2) ...
Selecting previously unselected package libicu55:armhf.
Preparing to unpack .../libicu55_55.1-7_armhf.deb ...
Unpacking libicu55:armhf (55.1-7) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../libxml2_2.9.3+dfsg1-1_armhf.deb ...
Unpacking libxml2:armhf (2.9.3+dfsg1-1) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../libsigsegv2_2.10-5_armhf.deb ...
Unpacking libsigsegv2:armhf (2.10-5) ...
Selecting previously unselected package m4.
Preparing to unpack .../archives/m4_1.4.17-5_armhf.deb ...
Unpacking m4 (1.4.17-5) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../autoconf_2.69-10_all.deb ...
Unpacking autoconf (2.69-10) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../autotools-dev_20150820.1_all.deb ...
Unpacking autotools-dev (20150820.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../automake_1%3a1.15-4_all.deb ...
Unpacking automake (1:1.15-4) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../autopoint_0.19.7-2_all.deb ...
Unpacking autopoint (0.19.7-2) ...
Selecting previously unselected package openssl.
Preparing to unpack .../openssl_1.0.2g-2_armhf.deb ...
Unpacking openssl (1.0.2g-2) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../ca-certificates_20160104_all.deb ...
Unpacking ca-certificates (20160104) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../libglib2.0-0_2.48.0-1_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.48.0-1) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../libcroco3_0.6.11-1_armhf.deb ...
Unpacking libcroco3:armhf (0.6.11-1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../gettext_0.19.7-2_armhf.deb ...
Unpacking gettext (0.19.7-2) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../po-debconf_1.0.19_all.deb ...
Unpacking po-debconf (1.0.19) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../libarchive-zip-perl_1.57-1_all.deb ...
Unpacking libarchive-zip-perl (1.57-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../libfile-stripnondeterminism-perl_0.016-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (0.016-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../dh-strip-nondeterminism_0.016-1_all.deb ...
Unpacking dh-strip-nondeterminism (0.016-1) ...
Selecting previously unselected package libtool.
Preparing to unpack .../libtool_2.4.6-0.1_all.deb ...
Unpacking libtool (2.4.6-0.1) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../dh-autoreconf_12_all.deb ...
Unpacking dh-autoreconf (12) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../debhelper_9.20160403_all.deb ...
Unpacking debhelper (9.20160403) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../x11-common_1%3a7.7+15_all.deb ...
Unpacking x11-common (1:7.7+15) ...
Selecting previously unselected package libice6:armhf.
Preparing to unpack .../libice6_2%3a1.0.9-1+b1_armhf.deb ...
Unpacking libice6:armhf (2:1.0.9-1+b1) ...
Selecting previously unselected package libsm6:armhf.
Preparing to unpack .../libsm6_2%3a1.2.2-1+b1_armhf.deb ...
Unpacking libsm6:armhf (2:1.2.2-1+b1) ...
Selecting previously unselected package libxt6:armhf.
Preparing to unpack .../libxt6_1%3a1.1.5-1_armhf.deb ...
Unpacking libxt6:armhf (1:1.1.5-1) ...
Selecting previously unselected package libxmu6:armhf.
Preparing to unpack .../libxmu6_2%3a1.1.2-2_armhf.deb ...
Unpacking libxmu6:armhf (2:1.1.2-2) ...
Selecting previously unselected package libxpm4:armhf.
Preparing to unpack .../libxpm4_1%3a3.5.11-1+b1_armhf.deb ...
Unpacking libxpm4:armhf (1:3.5.11-1+b1) ...
Selecting previously unselected package libxaw7:armhf.
Preparing to unpack .../libxaw7_2%3a1.0.13-1_armhf.deb ...
Unpacking libxaw7:armhf (2:1.0.13-1) ...
Selecting previously unselected package groff.
Preparing to unpack .../groff_1.22.3-7_armhf.deb ...
Unpacking groff (1.22.3-7) ...
Selecting previously unselected package python-markdown.
Preparing to unpack .../python-markdown_2.6.6-1_all.deb ...
Unpacking python-markdown (2.6.6-1) ...
Selecting previously unselected package rubygems-integration.
Preparing to unpack .../rubygems-integration_1.10_all.deb ...
Unpacking rubygems-integration (1.10) ...
Selecting previously unselected package ruby-did-you-mean.
Preparing to unpack .../ruby-did-you-mean_1.0.0-2_all.deb ...
Unpacking ruby-did-you-mean (1.0.0-2) ...
Selecting previously unselected package ruby-minitest.
Preparing to unpack .../ruby-minitest_5.8.4-2_all.deb ...
Unpacking ruby-minitest (5.8.4-2) ...
Selecting previously unselected package ruby-net-telnet.
Preparing to unpack .../ruby-net-telnet_0.1.1-2_all.deb ...
Unpacking ruby-net-telnet (0.1.1-2) ...
Selecting previously unselected package ruby-power-assert.
Preparing to unpack .../ruby-power-assert_0.2.7-1_all.deb ...
Unpacking ruby-power-assert (0.2.7-1) ...
Selecting previously unselected package ruby-test-unit.
Preparing to unpack .../ruby-test-unit_3.1.7-2_all.deb ...
Unpacking ruby-test-unit (3.1.7-2) ...
Selecting previously unselected package libruby2.3:armhf.
Preparing to unpack .../libruby2.3_2.3.1-1_armhf.deb ...
Unpacking libruby2.3:armhf (2.3.1-1) ...
Selecting previously unselected package ruby2.3.
Preparing to unpack .../ruby2.3_2.3.1-1_armhf.deb ...
Unpacking ruby2.3 (2.3.1-1) ...
Selecting previously unselected package ruby.
Preparing to unpack .../ruby_1%3a2.3.0+4_armhf.deb ...
Unpacking ruby (1:2.3.0+4) ...
Selecting previously unselected package rake.
Preparing to unpack .../archives/rake_10.5.0-2_all.deb ...
Unpacking rake (10.5.0-2) ...
Selecting previously unselected package ruby-fast-xs.
Preparing to unpack .../ruby-fast-xs_0.8.0-3+b4_armhf.deb ...
Unpacking ruby-fast-xs (0.8.0-3+b4) ...
Selecting previously unselected package ruby-hpricot.
Preparing to unpack .../ruby-hpricot_0.8.6-6+b1_armhf.deb ...
Unpacking ruby-hpricot (0.8.6-6+b1) ...
Selecting previously unselected package ruby-mustache.
Preparing to unpack .../ruby-mustache_1.0.2-1_all.deb ...
Unpacking ruby-mustache (1.0.2-1) ...
Selecting previously unselected package ruby-rdiscount.
Preparing to unpack .../ruby-rdiscount_2.1.8-1+b1_armhf.deb ...
Unpacking ruby-rdiscount (2.1.8-1+b1) ...
Selecting previously unselected package ruby-ronn.
Preparing to unpack .../ruby-ronn_0.7.3-4_all.deb ...
Unpacking ruby-ronn (0.7.3-4) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../zlib1g-dev_1%3a1.2.8.dfsg-2+b1_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.8.dfsg-2+b1) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../sbuild-build-depends-seqprep-dummy.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.22-5) ...
Processing triggers for systemd (229-4) ...
Setting up groff-base (1.22.3-7) ...
Setting up libbsd0:armhf (0.8.3-1) ...
Setting up bsdmainutils (9.0.10) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up libpipeline1:armhf (1.4.1-2) ...
Setting up man-db (2.7.5-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up mime-support (3.59) ...
Setting up libexpat1:armhf (2.1.1-1) ...
Setting up libffi6:armhf (3.2.1-4) ...
Setting up libsqlite3-0:armhf (3.12.2-1) ...
Setting up libssl1.0.2:armhf (1.0.2g-2) ...
Setting up libpython2.7-stdlib:armhf (2.7.11-8) ...
Setting up python2.7 (2.7.11-8) ...
Setting up libpython-stdlib:armhf (2.7.11-1) ...
Setting up python (2.7.11-1) ...
Setting up libmarkdown2:armhf (2.1.8-2) ...
Setting up libunistring0:armhf (0.9.3-5.2) ...
Setting up libxau6:armhf (1:1.0.8-1) ...
Setting up libxdmcp6:armhf (1:1.1.2-1.1) ...
Setting up libxcb1:armhf (1.11.1-1) ...
Setting up libx11-data (2:1.6.3-1) ...
Setting up libx11-6:armhf (2:1.6.3-1) ...
Setting up libxext6:armhf (2:1.3.3-1) ...
Setting up libyaml-0-2:armhf (0.1.6-3) ...
Setting up libmagic1:armhf (1:5.25-2) ...
Setting up file (1:5.25-2) ...
Setting up gettext-base (0.19.7-2) ...
Setting up libicu55:armhf (55.1-7) ...
Setting up libxml2:armhf (2.9.3+dfsg1-1) ...
Setting up libsigsegv2:armhf (2.10-5) ...
Setting up m4 (1.4.17-5) ...
Setting up autoconf (2.69-10) ...
Setting up autotools-dev (20150820.1) ...
Setting up automake (1:1.15-4) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Setting up autopoint (0.19.7-2) ...
Setting up openssl (1.0.2g-2) ...
Setting up ca-certificates (20160104) ...
Setting up libglib2.0-0:armhf (2.48.0-1) ...
No schema files found: doing nothing.
Setting up libcroco3:armhf (0.6.11-1) ...
Setting up gettext (0.19.7-2) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up po-debconf (1.0.19) ...
Setting up libarchive-zip-perl (1.57-1) ...
Setting up libfile-stripnondeterminism-perl (0.016-1) ...
Setting up libtool (2.4.6-0.1) ...
Setting up x11-common (1:7.7+15) ...
update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
Running in chroot, ignoring request.
All runlevel operations denied by policy
invoke-rc.d: policy-rc.d denied execution of start.
Setting up libice6:armhf (2:1.0.9-1+b1) ...
Setting up libsm6:armhf (2:1.2.2-1+b1) ...
Setting up libxt6:armhf (1:1.1.5-1) ...
Setting up libxmu6:armhf (2:1.1.2-2) ...
Setting up libxpm4:armhf (1:3.5.11-1+b1) ...
Setting up libxaw7:armhf (2:1.0.13-1) ...
Setting up groff (1.22.3-7) ...
Setting up python-markdown (2.6.6-1) ...
Setting up rubygems-integration (1.10) ...
Setting up ruby-did-you-mean (1.0.0-2) ...
Setting up ruby-minitest (5.8.4-2) ...
Setting up ruby-net-telnet (0.1.1-2) ...
Setting up ruby-power-assert (0.2.7-1) ...
Setting up ruby-test-unit (3.1.7-2) ...
Setting up zlib1g-dev:armhf (1:1.2.8.dfsg-2+b1) ...
Setting up dh-autoreconf (12) ...
Setting up rake (10.5.0-2) ...
Setting up libruby2.3:armhf (2.3.1-1) ...
Setting up ruby2.3 (2.3.1-1) ...
Setting up ruby-mustache (1.0.2-1) ...
Setting up debhelper (9.20160403) ...
Setting up ruby (1:2.3.0+4) ...
Setting up ruby-fast-xs (0.8.0-3+b4) ...
Setting up ruby-hpricot (0.8.6-6+b1) ...
Setting up ruby-rdiscount (2.1.8-1+b1) ...
Setting up ruby-ronn (0.7.3-4) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up dh-strip-nondeterminism (0.016-1) ...
Processing triggers for libc-bin (2.22-5) ...
Processing triggers for ca-certificates (20160104) ...
Updating certificates in /etc/ssl/certs...
173 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.
Processing triggers for systemd (229-4) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 3.19.0-trunk-armmp armhf (armv7l)
Toolchain package versions: binutils_2.26-8 dpkg-dev_1.18.4 g++-5_5.3.1-14 gcc-5_5.3.1-14 libc6-dev_2.22-5 libstdc++-4.9-dev_4.9.3-12 libstdc++-5-dev_5.3.1-14 libstdc++6_5.3.1-14 linux-libc-dev_3.18.5-1~exp1+rpi19+stretch
Package versions: acl_2.2.52-3 adduser_3.114 apt_1.2.10 autoconf_2.69-10 automake_1:1.15-4 autopoint_0.19.7-2 autotools-dev_20150820.1 base-files_9.6+rpi1 base-passwd_3.5.39 bash_4.3-14 binutils_2.26-8 bsdmainutils_9.0.10 bsdutils_1:2.27.1-6 build-essential_11.7 bzip2_1.0.6-8 ca-certificates_20160104 coreutils_8.25-2 cpio_2.11+dfsg-5 cpp_4:5.3.1-1+rpi1 cpp-5_5.3.1-14 dash_0.5.8-2.2 debconf_1.5.59 debfoster_2.7-2 debhelper_9.20160403 debianutils_4.7 dh-autoreconf_12 dh-strip-nondeterminism_0.016-1 diffutils_1:3.3-3 dmsetup_2:1.02.120-1 dpkg_1.18.4 dpkg-dev_1.18.4 e2fslibs_1.43~WIP.2016.03.15-2 e2fsprogs_1.43~WIP.2016.03.15-2 fakeroot_1.20.2-1 file_1:5.25-2 findutils_4.6.0+git+20160126-2 g++_4:5.3.1-1+rpi1 g++-5_5.3.1-14 gcc_4:5.3.1-1+rpi1 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-11+rpi1 gcc-4.8-base_4.8.5-4 gcc-4.9-base_4.9.3-12 gcc-5_5.3.1-14 gcc-5-base_5.3.1-14 gettext_0.19.7-2 gettext-base_0.19.7-2 gnupg_1.4.20-5 gpgv_1.4.20-5 grep_2.22-1 groff_1.22.3-7 groff-base_1.22.3-7 gzip_1.6-5 hostname_3.17 init_1.29 init-system-helpers_1.29 initscripts_2.88dsf-59.3 insserv_1.14.0-5.3 intltool-debian_0.35.0+20060710.4 klibc-utils_2.0.4-8+rpi1 kmod_22-1.1 libacl1_2.2.52-3 libapparmor1_2.10-4 libapt-pkg4.12_1.0.9.10 libapt-pkg5.0_1.2.10 libarchive-zip-perl_1.57-1 libasan1_4.9.3-12 libasan2_5.3.1-14 libatomic1_5.3.1-14 libattr1_1:2.4.47-2 libaudit-common_1:2.4.5-1 libaudit1_1:2.4.5-1 libblkid1_2.27.1-6 libbsd0_0.8.3-1 libbz2-1.0_1.0.6-8 libc-bin_2.22-5 libc-dev-bin_2.22-5 libc6_2.22-5 libc6-dev_2.22-5 libcap2_1:2.24-12 libcap2-bin_1:2.24-12 libcc1-0_5.3.1-14 libcomerr2_1.43~WIP.2016.03.15-2 libcroco3_0.6.11-1 libcryptsetup4_2:1.7.0-2 libdb5.3_5.3.28-11 libdbus-1-3_1.10.8-1 libdebconfclient0_0.208 libdevmapper1.02.1_2:1.02.120-1 libdpkg-perl_1.18.4 libdrm2_2.4.67-1 libexpat1_2.1.1-1 libfakeroot_1.20.2-1 libfdisk1_2.27.1-6 libffi6_3.2.1-4 libfile-stripnondeterminism-perl_0.016-1 libgc1c2_1:7.4.2-7.4 libgcc-4.9-dev_4.9.3-12 libgcc-5-dev_5.3.1-14 libgcc1_1:5.3.1-14 libgcrypt20_1.6.5-2 libgdbm3_1.8.3-13.1 libglib2.0-0_2.48.0-1 libgmp10_2:6.1.0+dfsg-2 libgomp1_5.3.1-14 libgpg-error0_1.21-2 libice6_2:1.0.9-1+b1 libicu55_55.1-7 libisl15_0.16.1-1 libklibc_2.0.4-8+rpi1 libkmod2_22-1.1 liblz4-1_0.0~r131-2 liblzma5_5.1.1alpha+20120614-2.1 libmagic1_1:5.25-2 libmarkdown2_2.1.8-2 libmount1_2.27.1-6 libmpc3_1.0.3-1 libmpfr4_3.1.4-1 libncurses5_6.0+20160319-1 libncursesw5_6.0+20160319-1 libpam-modules_1.1.8-3.2 libpam-modules-bin_1.1.8-3.2 libpam-runtime_1.1.8-3.2 libpam0g_1.1.8-3.2 libpcre3_2:8.38-3.1 libperl5.22_5.22.1-9 libpipeline1_1.4.1-2 libpng12-0_1.2.54-6 libprocps3_2:3.3.9-9 libprocps5_2:3.3.11-3 libpython-stdlib_2.7.11-1 libpython2.7-minimal_2.7.11-8 libpython2.7-stdlib_2.7.11-8 libreadline6_6.3-8+b3 libruby2.3_2.3.1-1 libseccomp2_2.3.0-1 libselinux1_2.4-3 libsemanage-common_2.4-3 libsemanage1_2.4-3 libsepol1_2.4-2 libsigsegv2_2.10-5 libslang2_2.3.0-2.3 libsm6_2:1.2.2-1+b1 libsmartcols1_2.27.1-6 libsqlite3-0_3.12.2-1 libss2_1.43~WIP.2016.03.15-2 libssl1.0.2_1.0.2g-2 libstdc++-4.9-dev_4.9.3-12 libstdc++-5-dev_5.3.1-14 libstdc++6_5.3.1-14 libsystemd0_229-4 libtimedate-perl_2.3000-2 libtinfo5_6.0+20160319-1 libtool_2.4.6-0.1 libubsan0_5.3.1-14 libudev1_229-4 libunistring0_0.9.3-5.2 libusb-0.1-4_2:0.1.12-28 libustr-1.0-1_1.0.4-5 libuuid1_2.27.1-6 libx11-6_2:1.6.3-1 libx11-data_2:1.6.3-1 libxau6_1:1.0.8-1 libxaw7_2:1.0.13-1 libxcb1_1.11.1-1 libxdmcp6_1:1.1.2-1.1 libxext6_2:1.3.3-1 libxml2_2.9.3+dfsg1-1 libxmu6_2:1.1.2-2 libxpm4_1:3.5.11-1+b1 libxt6_1:1.1.5-1 libyaml-0-2_0.1.6-3 linux-libc-dev_3.18.5-1~exp1+rpi19+stretch login_1:4.2-3.1 lsb-base_9.20160110+rpi1 m4_1.4.17-5 make_4.1-9 makedev_2.3.1-93 man-db_2.7.5-1 manpages_4.05-1 mawk_1.3.3-17 mime-support_3.59 mount_2.27.1-6 multiarch-support_2.22-5 nano_2.5.3-2 ncurses-base_6.0+20160319-1 ncurses-bin_6.0+20160319-1 openssl_1.0.2g-2 passwd_1:4.2-3.1 patch_2.7.5-1 perl_5.22.1-9 perl-base_5.22.1-9 perl-modules-5.22_5.22.1-9 po-debconf_1.0.19 procps_2:3.3.11-3 python_2.7.11-1 python-markdown_2.6.6-1 python-minimal_2.7.11-1 python2.7_2.7.11-8 python2.7-minimal_2.7.11-8 rake_10.5.0-2 raspbian-archive-keyring_20120528.2 readline-common_6.3-8 ruby_1:2.3.0+4 ruby-did-you-mean_1.0.0-2 ruby-fast-xs_0.8.0-3+b4 ruby-hpricot_0.8.6-6+b1 ruby-minitest_5.8.4-2 ruby-mustache_1.0.2-1 ruby-net-telnet_0.1.1-2 ruby-power-assert_0.2.7-1 ruby-rdiscount_2.1.8-1+b1 ruby-ronn_0.7.3-4 ruby-test-unit_3.1.7-2 ruby2.3_2.3.1-1 rubygems-integration_1.10 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.2.2-7.1 sensible-utils_0.0.9 startpar_0.59-3 systemd_229-4 systemd-sysv_229-4 sysv-rc_2.88dsf-59.3 sysvinit-utils_2.88dsf-59.3 tar_1.28-2.1 tzdata_2016c-0+deb8u1 udev_229-4 util-linux_2.27.1-6 x11-common_1:7.7+15 xz-utils_5.1.1alpha+20120614-2.1 zlib1g_1:1.2.8.dfsg-2+b1 zlib1g-dev_1:1.2.8.dfsg-2+b1
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: keyblock resource `/sbuild-nonexistent/.gnupg/trustedkeys.gpg': file open error
gpgv: Signature made Thu Apr 28 18:38:06 2016 UTC using RSA key ID D1C646D1
gpgv: Can't check signature: public key not found
dpkg-source: warning: failed to verify signature on ./seqprep_1.2-1.dsc
dpkg-source: info: extracting seqprep in seqprep-1.2
dpkg-source: info: unpacking seqprep_1.2.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.2-1.debian.tar.xz
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
Check disc space
----------------
Sufficient free space for build
User Environment
----------------
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=stretch-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=stretch-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=stretch-staging-armhf-sbuild-67e846a1-46e3-4ebc-bf7b-6531717edfeb
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=linux
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: source package seqprep
dpkg-buildpackage: source version 1.2-1
dpkg-buildpackage: source distribution unstable
dpkg-source --before-build seqprep-1.2
dpkg-buildpackage: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_testdir
dh_auto_clean
make -j1 clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
rm -f SeqPrep.o utils.o stdaln.o SeqPrep
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_clean
rm -f seqprep
rm -f debian/*.1
rm -f README.html
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules build-arch
dh build-arch
dh_testdir -a
dh_update_autotools_config -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_build
make -j1
make[2]: Entering directory '/<<PKGBUILDDIR>>'
cc -g -O2 -fPIE -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o
SeqPrep.c: In function 'main':
SeqPrep.c:164:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration]
while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:6ghz" )) != -1 ) {
^
cc -g -O2 -fPIE -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o
cc -g -O2 -fPIE -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o
cc SeqPrep.o utils.o stdaln.o -fPIE -pie -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep
make[2]: Leaving directory '/<<PKGBUILDDIR>>'
cp SeqPrep seqprep
TZ=UTC ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn
roff: debian/seqprep.1
markdown_py -f README.html README.md
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
Processing reads... |/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 100000
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.958797
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
Processing reads... |/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 100000
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 2.096765
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j1 install DESTDIR=/<<PKGBUILDDIR>>/debian/tmp AM_UPDATE_INFO_DIR=no
make[1]: Entering directory '/<<PKGBUILDDIR>>'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
Makefile:15: recipe for target 'install' failed
make[1]: [install] Error 1 (ignored)
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_strip_nondeterminism -a
dh_compress -a
dh_fixperms -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dh_installdeb -a
dh_gencontrol -a
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.2-1_armhf.deb'.
dpkg-deb: building package 'seqprep' in '../seqprep_1.2-1_armhf.deb'.
dpkg-genchanges -B -mRaspbian wandboard test autobuilder <root@raspbian.org> >../seqprep_1.2-1_armhf.changes
dpkg-genchanges: warning: package seqprep-dbgsym listed in files list but not in control info
dpkg-genchanges: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build seqprep-1.2
dpkg-buildpackage: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 20160504-1137
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
seqprep_1.2-1_armhf.changes:
----------------------------
Format: 1.8
Date: Thu, 28 Apr 2016 20:36:22 +0200
Source: seqprep
Binary: seqprep seqprep-data
Architecture: armhf
Version: 1.2-1
Distribution: stretch-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
seqprep-data - example data set for seqprep - only used for testing
Changes:
seqprep (1.2-1) unstable; urgency=medium
.
* New upstream version
Checksums-Sha1:
394e6210ce963848d8d7baf497b2b5ae2926b036 15736 seqprep-dbgsym_1.2-1_armhf.deb
b3cd1b75596b792b034bd0268ef4ac9eec572e6e 27168 seqprep_1.2-1_armhf.deb
Checksums-Sha256:
2ddafc43accf8da7a85cad95e9c2938391885bf31f6f97e6f9652c63b5b0433d 15736 seqprep-dbgsym_1.2-1_armhf.deb
7309a2135553ca1fc441746d5bef35baae89fc5fb8c4bc64e08e2c531110acf4 27168 seqprep_1.2-1_armhf.deb
Files:
9dc156590b1ad6beefb62003df0b20ad 15736 debug extra seqprep-dbgsym_1.2-1_armhf.deb
c30001b7a1f10b998dea300ce2e563db 27168 science optional seqprep_1.2-1_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
seqprep-dbgsym_1.2-1_armhf.deb
------------------------------
new debian package, version 2.0.
size 15736 bytes: control archive=492 bytes.
407 bytes, 13 lines control
106 bytes, 1 lines md5sums
Package: seqprep-dbgsym
Source: seqprep
Version: 1.2-1
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 31
Depends: seqprep (= 1.2-1)
Section: debug
Priority: extra
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: Debug symbols for seqprep
Auto-Built-Package: debug-symbols
Build-Ids: 5fbab7283260ff3c5938e8f79721f470ebc9c145
drwxr-xr-x root/root 0 2016-05-04 11:37 ./
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/lib/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/lib/debug/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/lib/debug/.build-id/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/lib/debug/.build-id/5f/
-rw-r--r-- root/root 21104 2016-05-04 11:37 ./usr/lib/debug/.build-id/5f/bab7283260ff3c5938e8f79721f470ebc9c145.debug
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/doc/
lrwxrwxrwx root/root 0 2016-05-04 11:37 ./usr/share/doc/seqprep-dbgsym -> seqprep
seqprep_1.2-1_armhf.deb
-----------------------
new debian package, version 2.0.
size 27168 bytes: control archive=1016 bytes.
1170 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.2-1
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 122
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2016-05-04 11:37 ./
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/bin/
-rwxr-xr-x root/root 94696 2016-05-04 11:37 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/doc/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11749 2016-05-04 11:32 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 802 2016-04-28 18:36 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1375 2015-02-20 13:25 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/man/
drwxr-xr-x root/root 0 2016-05-04 11:37 ./usr/share/man/man1/
-rw-r--r-- root/root 4568 2016-05-04 11:37 ./usr/share/man/man1/seqprep.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 65036
Build-Time: 286
Distribution: stretch-staging
Host Architecture: armhf
Install-Time: 427
Job: seqprep_1.2-1
Machine Architecture: armhf
Package: seqprep
Package-Time: 762
Source-Version: 1.2-1
Space: 65036
Status: successful
Version: 1.2-1
--------------------------------------------------------------------------------
Finished at 20160504-1137
Build needed 00:12:42, 65036k disc space