seqprep →
1.1-4 →
armhf → 2015-10-04 19:15:26
sbuild (Debian sbuild) 0.65.2 (24 Mar 2015) on testwandboard
╔══════════════════════════════════════════════════════════════════════════════╗
║ seqprep 1.1-4 (armhf) 04 Oct 2015 19:04 ║
╚══════════════════════════════════════════════════════════════════════════════╝
Package: seqprep
Version: 1.1-4
Source Version: 1.1-4
Distribution: stretch-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'build/seqprep-eAvkfe/seqprep-1.1' with '«PKGBUILDDIR»'
I: NOTICE: Log filtering will replace 'build/seqprep-eAvkfe' with '«BUILDDIR»'
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/stretch-staging-armhf-sbuild-3f7d0b49-60f8-44c4-8b43-d4f633f3429c' with '«CHROOT»'
┌──────────────────────────────────────────────────────────────────────────────┐
│ Update chroot │
└──────────────────────────────────────────────────────────────────────────────┘
Get:1 http://172.17.0.1 stretch-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1 stretch-staging/main Sources [8344 kB]
Get:3 http://172.17.0.1 stretch-staging/main armhf Packages [10.2 MB]
Ign http://172.17.0.1 stretch-staging/main Translation-en
Fetched 18.6 MB in 36s (506 kB/s)
Reading package lists...
┌──────────────────────────────────────────────────────────────────────────────┐
│ Fetch source files │
└──────────────────────────────────────────────────────────────────────────────┘
Check APT
─────────
Checking available source versions...
Download source files with APT
──────────────────────────────
Reading package lists...
Building dependency tree...
Reading state information...
NOTICE: 'seqprep' packaging is maintained in the 'Svn' version control system at:
svn://anonscm.debian.org/debian-med/trunk/packages/seqprep/trunk/
Need to get 37.2 MB of source archives.
Get:1 http://172.17.0.1/private/ stretch-staging/main seqprep 1.1-4 (dsc) [2083 B]
Get:2 http://172.17.0.1/private/ stretch-staging/main seqprep 1.1-4 (tar) [37.2 MB]
Get:3 http://172.17.0.1/private/ stretch-staging/main seqprep 1.1-4 (diff) [8828 B]
Fetched 37.2 MB in 29s (1261 kB/s)
Download complete and in download only mode
Check architectures
───────────────────
Check dependencies
──────────────────
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/«BUILDDIR»/resolver-1znhq1/apt_archive/sbuild-build-depends-core-dummy.deb'.
OK
Ign file: ./ InRelease
Get:1 file: ./ Release.gpg [299 B]
Get:2 file: ./ Release [2119 B]
Ign file: ./ Translation-en
Reading package lists...
Reading package lists...
┌──────────────────────────────────────────────────────────────────────────────┐
│ Install core build dependencies (apt-based resolver) │
└──────────────────────────────────────────────────────────────────────────────┘
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
debconf: delaying package configuration, since apt-utils is not installed
0 upgraded, 1 newly installed, 0 to remove and 42 not upgraded.
Need to get 0 B/764 B of archives.
After this operation, 0 B of additional disk space will be used.
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 12972 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
Merged Build-Depends: libc6-dev | libc-dev, gcc (>= 4:4.9.1), g++ (>= 4:4.9.1), make, dpkg-dev (>= 1.17.11), debhelper (>= 9), python, python-markdown, ruby-ronn, zlib1g-dev
Filtered Build-Depends: libc6-dev, gcc (>= 4:4.9.1), g++ (>= 4:4.9.1), make, dpkg-dev (>= 1.17.11), debhelper (>= 9), python, python-markdown, ruby-ronn, zlib1g-dev
dpkg-deb: building package 'sbuild-build-depends-seqprep-dummy' in '/«BUILDDIR»/resolver-SGcGnp/apt_archive/sbuild-build-depends-seqprep-dummy.deb'.
OK
Ign file: ./ InRelease
Get:1 file: ./ Release.gpg [299 B]
Get:2 file: ./ Release [2119 B]
Ign file: ./ Translation-en
Reading package lists...
Reading package lists...
┌──────────────────────────────────────────────────────────────────────────────┐
│ Install seqprep build dependencies (apt-based resolver) │
└──────────────────────────────────────────────────────────────────────────────┘
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following extra packages will be installed:
bsdmainutils ca-certificates debhelper file gettext gettext-base groff-base
intltool-debian libcroco3 libexpat1 libffi6 libglib2.0-0 libicu55 libmagic1
libmarkdown2 libpipeline1 libpython-stdlib libpython2.7-minimal
libpython2.7-stdlib libruby2.1 libsqlite3-0 libssl1.0.0 libunistring0
libxml2 libyaml-0-2 man-db mime-support openssl po-debconf python
python-markdown python-minimal python2.7 python2.7-minimal ruby ruby-fast-xs
ruby-hpricot ruby-mustache ruby-rdiscount ruby-ronn ruby2.1
rubygems-integration zlib1g-dev
Suggested packages:
wamerican wordlist whois vacation dh-make gettext-doc autopoint
libasprintf-dev libgettextpo-dev groff less www-browser libmail-box-perl
python-doc python-tk python-markdown-doc python2.7-doc binfmt-support ri
ruby-dev bundler
Recommended packages:
curl wget lynx-cur libglib2.0-data shared-mime-info xdg-user-dirs xml-core
libmail-sendmail-perl python-pygments python-yaml libjs-jquery
The following NEW packages will be installed:
bsdmainutils ca-certificates debhelper file gettext gettext-base groff-base
intltool-debian libcroco3 libexpat1 libffi6 libglib2.0-0 libicu55 libmagic1
libmarkdown2 libpipeline1 libpython-stdlib libpython2.7-minimal
libpython2.7-stdlib libruby2.1 libsqlite3-0 libssl1.0.0 libunistring0
libxml2 libyaml-0-2 man-db mime-support openssl po-debconf python
python-markdown python-minimal python2.7 python2.7-minimal ruby ruby-fast-xs
ruby-hpricot ruby-mustache ruby-rdiscount ruby-ronn ruby2.1
rubygems-integration sbuild-build-depends-seqprep-dummy zlib1g-dev
0 upgraded, 44 newly installed, 0 to remove and 42 not upgraded.
Need to get 25.8 MB/25.8 MB of archives.
After this operation, 92.9 MB of additional disk space will be used.
Get:1 http://172.17.0.1/private/ stretch-staging/main groff-base armhf 1.22.3-1 [1085 kB]
Get:2 http://172.17.0.1/private/ stretch-staging/main bsdmainutils armhf 9.0.6 [177 kB]
Get:3 http://172.17.0.1/private/ stretch-staging/main libpipeline1 armhf 1.4.1-1 [23.9 kB]
Get:4 http://172.17.0.1/private/ stretch-staging/main man-db armhf 2.7.3-1 [975 kB]
Get:5 http://172.17.0.1/private/ stretch-staging/main libpython2.7-minimal armhf 2.7.10-4 [379 kB]
Get:6 http://172.17.0.1/private/ stretch-staging/main python2.7-minimal armhf 2.7.10-4 [1092 kB]
Get:7 http://172.17.0.1/private/ stretch-staging/main python-minimal armhf 2.7.9-1 [40.1 kB]
Get:8 http://172.17.0.1/private/ stretch-staging/main mime-support all 3.59 [36.4 kB]
Get:9 http://172.17.0.1/private/ stretch-staging/main libexpat1 armhf 2.1.0-7 [59.8 kB]
Get:10 http://172.17.0.1/private/ stretch-staging/main libffi6 armhf 3.2.1-3 [18.5 kB]
Get:11 http://172.17.0.1/private/ stretch-staging/main libsqlite3-0 armhf 3.8.11.1-1 [391 kB]
Get:12 http://172.17.0.1/private/ stretch-staging/main libssl1.0.0 armhf 1.0.2d-1 [882 kB]
Get:13 http://172.17.0.1/private/ stretch-staging/main libpython2.7-stdlib armhf 2.7.10-4 [1736 kB]
Get:14 http://172.17.0.1/private/ stretch-staging/main python2.7 armhf 2.7.10-4 [258 kB]
Get:15 http://172.17.0.1/private/ stretch-staging/main libpython-stdlib armhf 2.7.9-1 [19.6 kB]
Get:16 http://172.17.0.1/private/ stretch-staging/main python armhf 2.7.9-1 [151 kB]
Get:17 http://172.17.0.1/private/ stretch-staging/main libglib2.0-0 armhf 2.46.0-2 [2376 kB]
Get:18 http://172.17.0.1/private/ stretch-staging/main libicu55 armhf 55.1-5 [7378 kB]
Get:19 http://172.17.0.1/private/ stretch-staging/main libxml2 armhf 2.9.2+zdfsg1-4 [797 kB]
Get:20 http://172.17.0.1/private/ stretch-staging/main libcroco3 armhf 0.6.8-3 [121 kB]
Get:21 http://172.17.0.1/private/ stretch-staging/main libmarkdown2 armhf 2.1.8-2 [27.7 kB]
Get:22 http://172.17.0.1/private/ stretch-staging/main libunistring0 armhf 0.9.3-5.2 [253 kB]
Get:23 http://172.17.0.1/private/ stretch-staging/main libyaml-0-2 armhf 0.1.6-3 [41.5 kB]
Get:24 http://172.17.0.1/private/ stretch-staging/main libmagic1 armhf 1:5.25-2 [250 kB]
Get:25 http://172.17.0.1/private/ stretch-staging/main file armhf 1:5.25-2 [61.2 kB]
Get:26 http://172.17.0.1/private/ stretch-staging/main gettext-base armhf 0.19.6-1 [119 kB]
Get:27 http://172.17.0.1/private/ stretch-staging/main openssl armhf 1.0.2d-1 [683 kB]
Get:28 http://172.17.0.1/private/ stretch-staging/main ca-certificates all 20150426 [208 kB]
Get:29 http://172.17.0.1/private/ stretch-staging/main gettext armhf 0.19.6-1 [1393 kB]
Get:30 http://172.17.0.1/private/ stretch-staging/main intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:31 http://172.17.0.1/private/ stretch-staging/main po-debconf all 1.0.18 [248 kB]
Get:32 http://172.17.0.1/private/ stretch-staging/main debhelper all 9.20150811 [817 kB]
Get:33 http://172.17.0.1/private/ stretch-staging/main python-markdown all 2.6.2-1 [55.6 kB]
Get:34 http://172.17.0.1/private/ stretch-staging/main rubygems-integration all 1.9 [4754 B]
Get:35 http://172.17.0.1/private/ stretch-staging/main libruby2.1 armhf 2.1.5-4 [3015 kB]
Get:36 http://172.17.0.1/private/ stretch-staging/main ruby2.1 armhf 2.1.5-4 [276 kB]
Get:37 http://172.17.0.1/private/ stretch-staging/main ruby all 1:2.1.5.1 [9756 B]
Get:38 http://172.17.0.1/private/ stretch-staging/main ruby-fast-xs armhf 0.8.0-3+b2 [8288 B]
Get:39 http://172.17.0.1/private/ stretch-staging/main ruby-hpricot armhf 0.8.6-5+b1 [64.6 kB]
Get:40 http://172.17.0.1/private/ stretch-staging/main ruby-mustache all 1.0.2-1 [25.1 kB]
Get:41 http://172.17.0.1/private/ stretch-staging/main ruby-rdiscount armhf 2.1.8-1 [32.7 kB]
Get:42 http://172.17.0.1/private/ stretch-staging/main ruby-ronn all 0.7.3-3 [29.4 kB]
Get:43 http://172.17.0.1/private/ stretch-staging/main zlib1g-dev armhf 1:1.2.8.dfsg-2+b1 [197 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 25.8 MB in 19s (1302 kB/s)
Selecting previously unselected package groff-base.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 12972 files and directories currently installed.)
Preparing to unpack .../groff-base_1.22.3-1_armhf.deb ...
Unpacking groff-base (1.22.3-1) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../bsdmainutils_9.0.6_armhf.deb ...
Unpacking bsdmainutils (9.0.6) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../libpipeline1_1.4.1-1_armhf.deb ...
Unpacking libpipeline1:armhf (1.4.1-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../man-db_2.7.3-1_armhf.deb ...
Unpacking man-db (2.7.3-1) ...
Selecting previously unselected package libpython2.7-minimal:armhf.
Preparing to unpack .../libpython2.7-minimal_2.7.10-4_armhf.deb ...
Unpacking libpython2.7-minimal:armhf (2.7.10-4) ...
Selecting previously unselected package python2.7-minimal.
Preparing to unpack .../python2.7-minimal_2.7.10-4_armhf.deb ...
Unpacking python2.7-minimal (2.7.10-4) ...
Selecting previously unselected package python-minimal.
Preparing to unpack .../python-minimal_2.7.9-1_armhf.deb ...
Unpacking python-minimal (2.7.9-1) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../mime-support_3.59_all.deb ...
Unpacking mime-support (3.59) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../libexpat1_2.1.0-7_armhf.deb ...
Unpacking libexpat1:armhf (2.1.0-7) ...
Selecting previously unselected package libffi6:armhf.
Preparing to unpack .../libffi6_3.2.1-3_armhf.deb ...
Unpacking libffi6:armhf (3.2.1-3) ...
Selecting previously unselected package libsqlite3-0:armhf.
Preparing to unpack .../libsqlite3-0_3.8.11.1-1_armhf.deb ...
Unpacking libsqlite3-0:armhf (3.8.11.1-1) ...
Selecting previously unselected package libssl1.0.0:armhf.
Preparing to unpack .../libssl1.0.0_1.0.2d-1_armhf.deb ...
Unpacking libssl1.0.0:armhf (1.0.2d-1) ...
Selecting previously unselected package libpython2.7-stdlib:armhf.
Preparing to unpack .../libpython2.7-stdlib_2.7.10-4_armhf.deb ...
Unpacking libpython2.7-stdlib:armhf (2.7.10-4) ...
Selecting previously unselected package python2.7.
Preparing to unpack .../python2.7_2.7.10-4_armhf.deb ...
Unpacking python2.7 (2.7.10-4) ...
Selecting previously unselected package libpython-stdlib:armhf.
Preparing to unpack .../libpython-stdlib_2.7.9-1_armhf.deb ...
Unpacking libpython-stdlib:armhf (2.7.9-1) ...
Setting up libpython2.7-minimal:armhf (2.7.10-4) ...
Setting up python2.7-minimal (2.7.10-4) ...
Setting up python-minimal (2.7.9-1) ...
Selecting previously unselected package python.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 14337 files and directories currently installed.)
Preparing to unpack .../python_2.7.9-1_armhf.deb ...
Unpacking python (2.7.9-1) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../libglib2.0-0_2.46.0-2_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.46.0-2) ...
Selecting previously unselected package libicu55:armhf.
Preparing to unpack .../libicu55_55.1-5_armhf.deb ...
Unpacking libicu55:armhf (55.1-5) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../libxml2_2.9.2+zdfsg1-4_armhf.deb ...
Unpacking libxml2:armhf (2.9.2+zdfsg1-4) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../libcroco3_0.6.8-3_armhf.deb ...
Unpacking libcroco3:armhf (0.6.8-3) ...
Selecting previously unselected package libmarkdown2:armhf.
Preparing to unpack .../libmarkdown2_2.1.8-2_armhf.deb ...
Unpacking libmarkdown2:armhf (2.1.8-2) ...
Selecting previously unselected package libunistring0:armhf.
Preparing to unpack .../libunistring0_0.9.3-5.2_armhf.deb ...
Unpacking libunistring0:armhf (0.9.3-5.2) ...
Selecting previously unselected package libyaml-0-2:armhf.
Preparing to unpack .../libyaml-0-2_0.1.6-3_armhf.deb ...
Unpacking libyaml-0-2:armhf (0.1.6-3) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../libmagic1_1%3a5.25-2_armhf.deb ...
Unpacking libmagic1:armhf (1:5.25-2) ...
Selecting previously unselected package file.
Preparing to unpack .../file_1%3a5.25-2_armhf.deb ...
Unpacking file (1:5.25-2) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../gettext-base_0.19.6-1_armhf.deb ...
Unpacking gettext-base (0.19.6-1) ...
Selecting previously unselected package openssl.
Preparing to unpack .../openssl_1.0.2d-1_armhf.deb ...
Unpacking openssl (1.0.2d-1) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../ca-certificates_20150426_all.deb ...
Unpacking ca-certificates (20150426) ...
Selecting previously unselected package gettext.
Preparing to unpack .../gettext_0.19.6-1_armhf.deb ...
Unpacking gettext (0.19.6-1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../po-debconf_1.0.18_all.deb ...
Unpacking po-debconf (1.0.18) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../debhelper_9.20150811_all.deb ...
Unpacking debhelper (9.20150811) ...
Selecting previously unselected package python-markdown.
Preparing to unpack .../python-markdown_2.6.2-1_all.deb ...
Unpacking python-markdown (2.6.2-1) ...
Selecting previously unselected package rubygems-integration.
Preparing to unpack .../rubygems-integration_1.9_all.deb ...
Unpacking rubygems-integration (1.9) ...
Selecting previously unselected package libruby2.1:armhf.
Preparing to unpack .../libruby2.1_2.1.5-4_armhf.deb ...
Unpacking libruby2.1:armhf (2.1.5-4) ...
Selecting previously unselected package ruby2.1.
Preparing to unpack .../ruby2.1_2.1.5-4_armhf.deb ...
Unpacking ruby2.1 (2.1.5-4) ...
Selecting previously unselected package ruby.
Preparing to unpack .../ruby_1%3a2.1.5.1_all.deb ...
Unpacking ruby (1:2.1.5.1) ...
Selecting previously unselected package ruby-fast-xs.
Preparing to unpack .../ruby-fast-xs_0.8.0-3+b2_armhf.deb ...
Unpacking ruby-fast-xs (0.8.0-3+b2) ...
Selecting previously unselected package ruby-hpricot.
Preparing to unpack .../ruby-hpricot_0.8.6-5+b1_armhf.deb ...
Unpacking ruby-hpricot (0.8.6-5+b1) ...
Selecting previously unselected package ruby-mustache.
Preparing to unpack .../ruby-mustache_1.0.2-1_all.deb ...
Unpacking ruby-mustache (1.0.2-1) ...
Selecting previously unselected package ruby-rdiscount.
Preparing to unpack .../ruby-rdiscount_2.1.8-1_armhf.deb ...
Unpacking ruby-rdiscount (2.1.8-1) ...
Selecting previously unselected package ruby-ronn.
Preparing to unpack .../ruby-ronn_0.7.3-3_all.deb ...
Unpacking ruby-ronn (0.7.3-3) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../zlib1g-dev_1%3a1.2.8.dfsg-2+b1_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.8.dfsg-2+b1) ...
Selecting previously unselected package sbuild-build-depends-seqprep-dummy.
Preparing to unpack .../sbuild-build-depends-seqprep-dummy.deb ...
Unpacking sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Setting up groff-base (1.22.3-1) ...
Setting up bsdmainutils (9.0.6) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up libpipeline1:armhf (1.4.1-1) ...
Setting up man-db (2.7.3-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up mime-support (3.59) ...
Setting up libexpat1:armhf (2.1.0-7) ...
Setting up libffi6:armhf (3.2.1-3) ...
Setting up libsqlite3-0:armhf (3.8.11.1-1) ...
Setting up libssl1.0.0:armhf (1.0.2d-1) ...
Setting up libpython2.7-stdlib:armhf (2.7.10-4) ...
Setting up python2.7 (2.7.10-4) ...
Setting up libpython-stdlib:armhf (2.7.9-1) ...
Setting up python (2.7.9-1) ...
Setting up libglib2.0-0:armhf (2.46.0-2) ...
No schema files found: doing nothing.
Setting up libicu55:armhf (55.1-5) ...
Setting up libxml2:armhf (2.9.2+zdfsg1-4) ...
Setting up libcroco3:armhf (0.6.8-3) ...
Setting up libmarkdown2:armhf (2.1.8-2) ...
Setting up libunistring0:armhf (0.9.3-5.2) ...
Setting up libyaml-0-2:armhf (0.1.6-3) ...
Setting up libmagic1:armhf (1:5.25-2) ...
Setting up file (1:5.25-2) ...
Setting up gettext-base (0.19.6-1) ...
Setting up openssl (1.0.2d-1) ...
Setting up ca-certificates (20150426) ...
Setting up gettext (0.19.6-1) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up po-debconf (1.0.18) ...
Setting up debhelper (9.20150811) ...
Setting up python-markdown (2.6.2-1) ...
Setting up rubygems-integration (1.9) ...
Setting up libruby2.1:armhf (2.1.5-4) ...
Setting up ruby2.1 (2.1.5-4) ...
Setting up ruby (1:2.1.5.1) ...
Setting up ruby-fast-xs (0.8.0-3+b2) ...
Setting up ruby-hpricot (0.8.6-5+b1) ...
Setting up ruby-mustache (1.0.2-1) ...
Setting up ruby-rdiscount (2.1.8-1) ...
Setting up ruby-ronn (0.7.3-3) ...
Setting up zlib1g-dev:armhf (1:1.2.8.dfsg-2+b1) ...
Setting up sbuild-build-depends-seqprep-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.19-19) ...
Processing triggers for ca-certificates (20150426) ...
Updating certificates in /etc/ssl/certs...
180 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...
done.
┌──────────────────────────────────────────────────────────────────────────────┐
│ Build environment │
└──────────────────────────────────────────────────────────────────────────────┘
Kernel: Linux 3.19.0-trunk-armmp armhf (armv7l)
Toolchain package versions: binutils_2.25.1-1 dpkg-dev_1.18.2 g++-4.9_4.9.3-4 g++-5_5.2.1-16+rpi1 gcc-4.9_4.9.3-4 gcc-5_5.2.1-16+rpi1 libc6-dev_2.19-19 libstdc++-4.9-dev_4.9.3-4 libstdc++-5-dev_5.2.1-16+rpi1 libstdc++6_5.2.1-16+rpi1 linux-libc-dev_3.16.7-ckt4-1+rpi1+b2
Package versions: acl_2.2.52-2 adduser_3.113+nmu3 apt_1.0.10.2 base-files_9.4+rpi1 base-passwd_3.5.38 bash_4.3-14 binutils_2.25.1-1 bsdmainutils_9.0.6 bsdutils_1:2.26.2-9 build-essential_11.7 bzip2_1.0.6-8 ca-certificates_20150426 coreutils_8.23-4 cpio_2.11+dfsg-4.1 cpp_4:5.2.1-4+rpi2 cpp-4.9_4.9.3-4 cpp-5_5.2.1-16+rpi1 dash_0.5.7-4 debconf_1.5.57 debfoster_2.7-2 debhelper_9.20150811 debianutils_4.5.1 diffutils_1:3.3-1 dmsetup_2:1.02.104-1 dpkg_1.18.2 dpkg-dev_1.18.2 e2fslibs_1.42.13-1 e2fsprogs_1.42.13-1 fakeroot_1.20.2-1 file_1:5.25-2 findutils_4.4.2-9 g++_4:5.2.1-4+rpi2 g++-4.9_4.9.3-4 g++-5_5.2.1-16+rpi1 gcc_4:5.2.1-4+rpi2 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-11+rpi1 gcc-4.8-base_4.8.4-4 gcc-4.9_4.9.3-4 gcc-4.9-base_4.9.3-4 gcc-5_5.2.1-16+rpi1 gcc-5-base_5.2.1-16+rpi1 gettext_0.19.6-1 gettext-base_0.19.6-1 gnupg_1.4.19-5 gpgv_1.4.19-5 grep_2.21-2 groff-base_1.22.3-1 gzip_1.6-4 hostname_3.16 init_1.23 init-system-helpers_1.23 initramfs-tools_0.120 initscripts_2.88dsf-59.2 insserv_1.14.0-5 intltool-debian_0.35.0+20060710.4 klibc-utils_2.0.4-2+rpi1 kmod_21-1 libacl1_2.2.52-2 libapparmor1_2.9.2-3 libapt-pkg4.12_1.0.9.10 libapt-pkg4.16_1.0.10.2 libasan1_4.9.3-4 libasan2_5.2.1-16+rpi1 libatomic1_5.2.1-16+rpi1 libattr1_1:2.4.47-2 libaudit-common_1:2.4.4-1 libaudit1_1:2.4.4-1 libblkid1_2.26.2-9 libbz2-1.0_1.0.6-8 libc-bin_2.19-19 libc-dev-bin_2.19-19 libc6_2.19-19 libc6-dev_2.19-19 libcap2_1:2.24-11 libcap2-bin_1:2.24-11 libcc1-0_5.2.1-16+rpi1 libcloog-isl4_0.18.3-1 libcomerr2_1.42.13-1 libcroco3_0.6.8-3 libcryptsetup4_2:1.6.6-5 libdb5.3_5.3.28-11 libdbus-1-3_1.8.20-1 libdebconfclient0_0.195 libdevmapper1.02.1_2:1.02.104-1 libdpkg-perl_1.18.2 libdrm2_2.4.64-1 libexpat1_2.1.0-7 libfakeroot_1.20.2-1 libfdisk1_2.26.2-9 libffi6_3.2.1-3 libgc1c2_1:7.2d-6.4 libgcc-4.9-dev_4.9.3-4 libgcc-5-dev_5.2.1-16+rpi1 libgcc1_1:5.2.1-16+rpi1 libgcrypt20_1.6.3-2 libgdbm3_1.8.3-13.1 libglib2.0-0_2.46.0-2 libgmp10_2:6.0.0+dfsg-7+rpi1 libgomp1_5.2.1-16+rpi1 libgpg-error0_1.19-2 libicu55_55.1-5 libisl13_0.14-2 libklibc_2.0.4-2+rpi1 libkmod2_21-1 liblocale-gettext-perl_1.05-9 liblzma5_5.1.1alpha+20120614-2.1 libmagic1_1:5.25-2 libmarkdown2_2.1.8-2 libmount1_2.26.2-9 libmpc3_1.0.3-1 libmpfr4_3.1.3-1 libncurses5_6.0+20150810-1 libncursesw5_6.0+20150810-1 libnih-dbus1_1.0.3-4.3 libnih1_1.0.3-4.3 libpam-modules_1.1.8-3.1 libpam-modules-bin_1.1.8-3.1 libpam-runtime_1.1.8-3.1 libpam0g_1.1.8-3.1 libpcre3_2:8.35-7.1 libpipeline1_1.4.1-1 libpng12-0_1.2.50-2+b2 libprocps3_2:3.3.9-9 libprocps4_2:3.3.10-2 libpython-stdlib_2.7.9-1 libpython2.7-minimal_2.7.10-4 libpython2.7-stdlib_2.7.10-4 libreadline6_6.3-8+b3 libruby2.1_2.1.5-4 libseccomp2_2.2.3-2 libselinux1_2.3-2 libsemanage-common_2.3-1 libsemanage1_2.3-1 libsepol1_2.3-2 libslang2_2.3.0-2+b1 libsmartcols1_2.26.2-9 libsqlite3-0_3.8.11.1-1 libss2_1.42.13-1 libssl1.0.0_1.0.2d-1 libstdc++-4.9-dev_4.9.3-4 libstdc++-5-dev_5.2.1-16+rpi1 libstdc++6_5.2.1-16+rpi1 libsystemd0_225-1 libtext-charwidth-perl_0.04-7+b4 libtext-iconv-perl_1.7-5+b5 libtext-wrapi18n-perl_0.06-7.1 libtimedate-perl_2.3000-2 libtinfo5_6.0+20150810-1 libubsan0_5.2.1-16+rpi1 libudev1_225-1 libunistring0_0.9.3-5.2 libusb-0.1-4_2:0.1.12-27 libustr-1.0-1_1.0.4-5 libuuid1_2.26.2-9 libxml2_2.9.2+zdfsg1-4 libyaml-0-2_0.1.6-3 linux-libc-dev_3.16.7-ckt4-1+rpi1+b2 login_1:4.2-3 lsb-base_4.1+Debian13+rpi1+nmu1 make_4.0-8.2 makedev_2.3.1-93 man-db_2.7.3-1 mawk_1.3.3-17 mime-support_3.59 mount_2.26.2-9 mountall_2.54 multiarch-support_2.19-19 nano_2.4.2-1 ncurses-base_6.0+20150810-1 ncurses-bin_6.0+20150810-1 openssl_1.0.2d-1 passwd_1:4.2-3 patch_2.7.5-1 perl_5.20.2-6 perl-base_5.20.2-6 perl-modules_5.20.2-6 plymouth_0.9.0-9 po-debconf_1.0.18 procps_2:3.3.10-2 python_2.7.9-1 python-markdown_2.6.2-1 python-minimal_2.7.9-1 python2.7_2.7.10-4 python2.7-minimal_2.7.10-4 raspbian-archive-keyring_20120528.2 readline-common_6.3-8 ruby_1:2.1.5.1 ruby-fast-xs_0.8.0-3+b2 ruby-hpricot_0.8.6-5+b1 ruby-mustache_1.0.2-1 ruby-rdiscount_2.1.8-1 ruby-ronn_0.7.3-3 ruby2.1_2.1.5-4 rubygems-integration_1.9 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-seqprep-dummy_0.invalid.0 sed_4.2.2-6.1 sensible-utils_0.0.9 startpar_0.59-3 systemd_225-1 systemd-sysv_225-1 sysv-rc_2.88dsf-59.2 sysvinit-utils_2.88dsf-59.2 tar_1.28-1 tzdata_2015f-1 udev_225-1 util-linux_2.26.2-9 xz-utils_5.1.1alpha+20120614-2.1 zlib1g_1:1.2.8.dfsg-2+b1 zlib1g-dev_1:1.2.8.dfsg-2+b1
┌──────────────────────────────────────────────────────────────────────────────┐
│ Build │
└──────────────────────────────────────────────────────────────────────────────┘
Unpack source
─────────────
gpgv: keyblock resource `/sbuild-nonexistent/.gnupg/trustedkeys.gpg': file open error
gpgv: Signature made Mon Sep 28 11:48:48 2015 UTC using RSA key ID D1C646D1
gpgv: Can't check signature: public key not found
dpkg-source: warning: failed to verify signature on ./seqprep_1.1-4.dsc
dpkg-source: info: extracting seqprep in seqprep-1.1
dpkg-source: info: unpacking seqprep_1.1.orig.tar.gz
dpkg-source: info: unpacking seqprep_1.1-4.debian.tar.xz
dpkg-source: info: applying fix_unused_variable_errors.patch
dpkg-source: info: applying hardening.patch
dpkg-source: info: applying replace-float-with-double.patch
Check disc space
────────────────
Sufficient free space for build
User Environment
────────────────
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LOGNAME=root
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=stretch-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=stretch-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=stretch-staging-armhf-sbuild-3f7d0b49-60f8-44c4-8b43-d4f633f3429c
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=xterm
USER=buildd
dpkg-buildpackage
─────────────────
dpkg-buildpackage: source package seqprep
dpkg-buildpackage: source version 1.1-4
dpkg-buildpackage: source distribution unstable
dpkg-source --before-build seqprep-1.1
dpkg-buildpackage: host architecture armhf
fakeroot debian/rules clean
dh clean
dh_testdir
dh_auto_clean
make -j1 clean
make[1]: Entering directory '/«PKGBUILDDIR»'
rm SeqPrep.o utils.o stdaln.o SeqPrep
rm: cannot remove 'SeqPrep.o': No such file or directory
rm: cannot remove 'utils.o': No such file or directory
rm: cannot remove 'stdaln.o': No such file or directory
rm: cannot remove 'SeqPrep': No such file or directory
Makefile:22: recipe for target 'clean' failed
make[1]: [clean] Error 1 (ignored)
make[1]: Leaving directory '/«PKGBUILDDIR»'
debian/rules override_dh_clean
make[1]: Entering directory '/«PKGBUILDDIR»'
dh_clean
rm -f seqprep
rm -f debian/*.1
rm -f README.html
make[1]: Leaving directory '/«PKGBUILDDIR»'
debian/rules build-arch
dh build-arch
dh_testdir -a
dh_auto_configure -a
debian/rules override_dh_auto_build
make[1]: Entering directory '/«PKGBUILDDIR»'
dh_auto_build
make -j1
make[2]: Entering directory '/«PKGBUILDDIR»'
gcc -g -O2 -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -Werror -O0 -g SeqPrep.c -o SeqPrep.o
gcc -g -O2 -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -Werror -O0 -g utils.c -o utils.o
gcc -g -O2 -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -Werror -O0 -g stdaln.c -o stdaln.o
gcc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -lz -lm -o SeqPrep
make[2]: Leaving directory '/«PKGBUILDDIR»'
cp SeqPrep seqprep
ronn -r --manual=seqprep --organization='Cancer Therapeutics Innovation Group' debian/seqprep.1.ronn
roff: debian/seqprep.1
markdown_py -f README.html README.md
make[1]: Leaving directory '/«PKGBUILDDIR»'
debian/rules override_dh_auto_test
make[1]: Entering directory '/«PKGBUILDDIR»'
# This checks that the tests run and produce byte-identical results.
cd Test && mkdir -p out info && \
bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh'
+ . RUNTEST.sh
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz
Processing reads... |/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 100000
Pairs Merged: 14314
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.956834
++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz
Processing reads... |/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\|/-\fastq record not beginning with @
fastq record not beginning with @
Pairs Processed: 100000
Pairs Merged: 0
Pairs With Adapters: 4091
Pairs Discarded: 2228
CPU Time Used (Minutes): 1.894461
++ prog=gzcat
++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz
++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz
++ zcat ./out/pe_bad_contam_merged_1.fastq.gz
++ python seqlens.py
++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz
++ python seqlens.py
++ zcat ./out/pe_bad_contam_merged_2.fastq.gz
++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz
++ zcat ./out/pe_bad_contam_merged_s.fastq.gz
++ python seqlens.py
[ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ]
# remove output dirs right after testing to make sure the files
# will not be included in the data package
rm -rf Test/info Test/out
make[1]: Leaving directory '/«PKGBUILDDIR»'
fakeroot debian/rules binary-arch
dh binary-arch
dh_testroot -a
dh_prep -a
dh_auto_install -a
make -j1 install DESTDIR=/«PKGBUILDDIR»/debian/tmp AM_UPDATE_INFO_DIR=no
make[1]: Entering directory '/«PKGBUILDDIR»'
cp SeqPrep /sbuild-nonexistent/bin
cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory
Makefile:16: recipe for target 'install' failed
make[1]: [install] Error 1 (ignored)
make[1]: Leaving directory '/«PKGBUILDDIR»'
dh_install -a
dh_installdocs -a
dh_installchangelogs -a
dh_installman -a
dh_perl -a
dh_link -a
dh_compress -a
dh_fixperms -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dh_installdeb -a
dh_gencontrol -a
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
dh_md5sums -a
dh_builddeb -a
dpkg-deb: building package 'seqprep' in '../seqprep_1.1-4_armhf.deb'.
dpkg-genchanges -B -mRaspbian wandboard test autobuilder <root@raspbian.org> >../seqprep_1.1-4_armhf.changes
dpkg-genchanges: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build seqprep-1.1
dpkg-buildpackage: binary-only upload (no source included)
────────────────────────────────────────────────────────────────────────────────
Build finished at 20151004-1915
Finished
────────
I: Built successfully
┌──────────────────────────────────────────────────────────────────────────────┐
│ Post Build Chroot │
└──────────────────────────────────────────────────────────────────────────────┘
┌──────────────────────────────────────────────────────────────────────────────┐
│ Changes │
└──────────────────────────────────────────────────────────────────────────────┘
seqprep_1.1-4_armhf.changes:
────────────────────────────
Format: 1.8
Date: Mon, 28 Sep 2015 13:46:54 +0200
Source: seqprep
Binary: seqprep seqprep-data
Architecture: armhf
Version: 1.1-4
Distribution: stretch-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
seqprep - stripping adaptors and/or merging paired reads of DNA sequences w
seqprep-data - example data set for seqprep - only used for testing
Closes: 789829
Changes:
seqprep (1.1-4) unstable; urgency=medium
.
* Really apply patch created by Graham Inggs
Closes: #789829
Checksums-Sha1:
59e2738e8e78a626d0ab986120a5259eaeee1b2a 25724 seqprep_1.1-4_armhf.deb
Checksums-Sha256:
d0653577441f127bd8fc7706f75684fa49c3639b2545bbf43483ec41e86be7ba 25724 seqprep_1.1-4_armhf.deb
Files:
8b527c91cf35078641810859025c1f7c 25724 science optional seqprep_1.1-4_armhf.deb
┌──────────────────────────────────────────────────────────────────────────────┐
│ Package contents │
└──────────────────────────────────────────────────────────────────────────────┘
seqprep_1.1-4_armhf.deb
───────────────────────
new debian package, version 2.0.
size 25724 bytes: control archive=1016 bytes.
1170 bytes, 21 lines control
326 bytes, 5 lines md5sums
Package: seqprep
Version: 1.1-4
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 114
Depends: libc6 (>= 2.4), zlib1g (>= 1:1.1.4)
Section: science
Priority: optional
Homepage: http://seqanswers.com/wiki/SeqPrep
Description: stripping adaptors and/or merging paired reads of DNA sequences with overlap
SeqPrep is a program to merge paired end Illumina reads that are overlapping
into a single longer read. It may also just be used for its adapter trimming
feature without doing any paired end overlap. When an adapter sequence is
present, that means that the two reads must overlap (in most cases) so they
are forcefully merged. When reads do not have adapter sequence they must be
treated with care when doing the merging, so a much more specific approach is
taken. The default parameters were chosen with specificity in mind, so that
they could be ran on libraries where very few reads are expected to overlap.
It is always safest though to save the overlapping procedure for libraries
where you have some prior knowledge that a significant portion of the reads
will have some overlap.
drwxr-xr-x root/root 0 2015-10-04 19:15 ./
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/bin/
-rwxr-xr-x root/root 86544 2015-10-04 19:15 ./usr/bin/seqprep
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/share/
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/share/doc/
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/share/doc/seqprep/
-rw-r--r-- root/root 11704 2015-10-04 19:11 ./usr/share/doc/seqprep/README.html
-rw-r--r-- root/root 519 2015-09-28 11:46 ./usr/share/doc/seqprep/changelog.Debian.gz
-rw-r--r-- root/root 1375 2015-02-20 13:25 ./usr/share/doc/seqprep/copyright
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/share/man/
drwxr-xr-x root/root 0 2015-10-04 19:15 ./usr/share/man/man1/
-rw-r--r-- root/root 4569 2015-10-04 19:15 ./usr/share/man/man1/seqprep.1.gz
┌──────────────────────────────────────────────────────────────────────────────┐
│ Post Build │
└──────────────────────────────────────────────────────────────────────────────┘
┌──────────────────────────────────────────────────────────────────────────────┐
│ Cleanup │
└──────────────────────────────────────────────────────────────────────────────┘
Purging /«BUILDDIR»
Not cleaning session: cloned chroot in use
┌──────────────────────────────────────────────────────────────────────────────┐
│ Summary │
└──────────────────────────────────────────────────────────────────────────────┘
Build Architecture: armhf
Build-Space: 64932
Build-Time: 269
Distribution: stretch-staging
Host Architecture: armhf
Install-Time: 287
Job: seqprep_1.1-4
Machine Architecture: armhf
Package: seqprep
Package-Time: 654
Source-Version: 1.1-4
Space: 64932
Status: successful
Version: 1.1-4
────────────────────────────────────────────────────────────────────────────────
Finished at 20151004-1915
Build needed 00:10:54, 64932k disc space