Raspbian Package Auto-Building

Build log for mapsembler2 (2.0.31-1) on armhf

mapsembler22.0.31-1armhf → 2014-03-04 05:40:30

sbuild (Debian sbuild) 0.63.2 (18 Aug 2012) on bm-wb-04

╔══════════════════════════════════════════════════════════════════════════════╗
║ mapsembler2 2.0.31-1 (armhf)                               04 Mar 2014 05:36 ║
╚══════════════════════════════════════════════════════════════════════════════╝

Package: mapsembler2
Version: 2.0.31-1
Source Version: 2.0.31-1
Distribution: jessie-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf

I: NOTICE: Log filtering will replace 'build/mapsembler2-FNTjsm/mapsembler2-2.0.31' with '«PKGBUILDDIR»'
I: NOTICE: Log filtering will replace 'build/mapsembler2-FNTjsm' with '«BUILDDIR»'
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/jessie-staging-armhf-sbuild-ecaa07a1-0128-474b-a73d-507aa4346254' with '«CHROOT»'

┌──────────────────────────────────────────────────────────────────────────────┐
│ Update chroot                                                                │
└──────────────────────────────────────────────────────────────────────────────┘

Get:1 http://172.17.0.1 jessie-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1 jessie-staging/main Sources [7292 kB]
Get:3 http://172.17.0.1 jessie-staging/main armhf Packages [8449 kB]
Ign http://172.17.0.1 jessie-staging/main Translation-en
Fetched 15.8 MB in 36s (426 kB/s)
Reading package lists...

┌──────────────────────────────────────────────────────────────────────────────┐
│ Fetch source files                                                           │
└──────────────────────────────────────────────────────────────────────────────┘


Check APT
─────────

Checking available source versions...

Download source files with APT
──────────────────────────────

Reading package lists...
Building dependency tree...
Reading state information...
NOTICE: 'mapsembler2' packaging is maintained in the 'Svn' version control system at:
svn://anonscm.debian.org/debian-med/trunk/packages/mapsembler2/trunk/
Need to get 399 kB of source archives.
Get:1 http://172.17.0.1/private/ jessie-staging/main mapsembler2 2.0.31-1 (dsc) [2013 B]
Get:2 http://172.17.0.1/private/ jessie-staging/main mapsembler2 2.0.31-1 (tar) [385 kB]
Get:3 http://172.17.0.1/private/ jessie-staging/main mapsembler2 2.0.31-1 (diff) [11.5 kB]
Fetched 399 kB in 0s (3721 kB/s)
Download complete and in download only mode

Check arch
──────────

Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package `sbuild-build-depends-core-dummy' in `/«BUILDDIR»/resolver-dk1OSf/apt_archive/sbuild-build-depends-core-dummy.deb'.
OK
Reading package lists...

┌──────────────────────────────────────────────────────────────────────────────┐
│ Install core build dependencies (apt-based resolver)                         │
└──────────────────────────────────────────────────────────────────────────────┘

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following NEW packages will be installed:
  sbuild-build-depends-core-dummy
debconf: delaying package configuration, since apt-utils is not installed
0 upgraded, 1 newly installed, 0 to remove and 3 not upgraded.
Need to get 0 B/812 B of archives.
After this operation, 0 B of additional disk space will be used.
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 11633 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
Merged Build-Depends: base-files, base-passwd, bash, bsdutils, coreutils, dash, debianutils, diffutils, dpkg, e2fsprogs, findutils, grep, gzip, hostname, libc-bin, login, mount, ncurses-base, ncurses-bin, perl-base, sed, sysvinit, sysvinit-utils, tar, util-linux, libc6-dev | libc-dev, gcc (>= 4:4.4.3), g++ (>= 4:4.4.3), make, dpkg-dev (>= 1.13.5), debhelper (>= 9), bc, zlib1g-dev, help2man
Filtered Build-Depends: base-files, base-passwd, bash, bsdutils, coreutils, dash, debianutils, diffutils, dpkg, e2fsprogs, findutils, grep, gzip, hostname, libc-bin, login, mount, ncurses-base, ncurses-bin, perl-base, sed, sysvinit, sysvinit-utils, tar, util-linux, libc6-dev, gcc (>= 4:4.4.3), g++ (>= 4:4.4.3), make, dpkg-dev (>= 1.13.5), debhelper (>= 9), bc, zlib1g-dev, help2man
dpkg-deb: building package `sbuild-build-depends-mapsembler2-dummy' in `/«BUILDDIR»/resolver-7omsb3/apt_archive/sbuild-build-depends-mapsembler2-dummy.deb'.
OK
Reading package lists...

┌──────────────────────────────────────────────────────────────────────────────┐
│ Install mapsembler2 build dependencies (apt-based resolver)                  │
└──────────────────────────────────────────────────────────────────────────────┘

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following extra packages will be installed:
  bc bsdmainutils debhelper file gettext gettext-base groff-base help2man
  install-info intltool-debian libasprintf0c2 libcroco3 libffi6 libglib2.0-0
  libmagic1 libpipeline1 libunistring0 libxml2 man-db po-debconf zlib1g-dev
Suggested packages:
  wamerican wordlist whois vacation dh-make gettext-doc groff less www-browser
  libmail-box-perl
Recommended packages:
  curl wget lynx-cur autopoint libasprintf-dev libgettextpo-dev
  libglib2.0-data shared-mime-info xml-core libmail-sendmail-perl
The following NEW packages will be installed:
  bc bsdmainutils debhelper file gettext gettext-base groff-base help2man
  install-info intltool-debian libasprintf0c2 libcroco3 libffi6 libglib2.0-0
  libmagic1 libpipeline1 libunistring0 libxml2 man-db po-debconf
  sbuild-build-depends-mapsembler2-dummy zlib1g-dev
0 upgraded, 22 newly installed, 0 to remove and 3 not upgraded.
Need to get 8708 kB/8709 kB of archives.
After this operation, 23.5 MB of additional disk space will be used.
Get:1 http://172.17.0.1/private/ jessie-staging/main install-info armhf 5.2.0.dfsg.1-2 [194 kB]
Get:2 http://172.17.0.1/private/ jessie-staging/main libpipeline1 armhf 1.2.6-2 [20.3 kB]
Get:3 http://172.17.0.1/private/ jessie-staging/main groff-base armhf 1.22.2-5 [962 kB]
Get:4 http://172.17.0.1/private/ jessie-staging/main bsdmainutils armhf 9.0.5 [206 kB]
Get:5 http://172.17.0.1/private/ jessie-staging/main man-db armhf 2.6.6-1 [961 kB]
Get:6 http://172.17.0.1/private/ jessie-staging/main libasprintf0c2 armhf 0.18.3.2-1 [29.0 kB]
Get:7 http://172.17.0.1/private/ jessie-staging/main libmagic1 armhf 1:5.17-0.1 [224 kB]
Get:8 http://172.17.0.1/private/ jessie-staging/main libxml2 armhf 2.9.1+dfsg1-3 [836 kB]
Get:9 http://172.17.0.1/private/ jessie-staging/main libffi6 armhf 3.0.13-12 [17.4 kB]
Get:10 http://172.17.0.1/private/ jessie-staging/main libglib2.0-0 armhf 2.38.2-5 [2073 kB]
Get:11 http://172.17.0.1/private/ jessie-staging/main libcroco3 armhf 0.6.8-2 [119 kB]
Get:12 http://172.17.0.1/private/ jessie-staging/main libunistring0 armhf 0.9.3-5 [408 kB]
Get:13 http://172.17.0.1/private/ jessie-staging/main bc armhf 1.06.95-8 [106 kB]
Get:14 http://172.17.0.1/private/ jessie-staging/main file armhf 1:5.17-0.1 [54.8 kB]
Get:15 http://172.17.0.1/private/ jessie-staging/main gettext-base armhf 0.18.3.2-1 [112 kB]
Get:16 http://172.17.0.1/private/ jessie-staging/main gettext armhf 0.18.3.2-1 [1137 kB]
Get:17 http://172.17.0.1/private/ jessie-staging/main intltool-debian all 0.35.0+20060710.1 [29.8 kB]
Get:18 http://172.17.0.1/private/ jessie-staging/main po-debconf all 1.0.16+nmu2 [223 kB]
Get:19 http://172.17.0.1/private/ jessie-staging/main debhelper all 9.20131227 [687 kB]
Get:20 http://172.17.0.1/private/ jessie-staging/main help2man armhf 1.44.1 [94.9 kB]
Get:21 http://172.17.0.1/private/ jessie-staging/main zlib1g-dev armhf 1:1.2.8.dfsg-1 [212 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 8708 kB in 2s (3544 kB/s)
Selecting previously unselected package install-info.
(Reading database ... 11633 files and directories currently installed.)
Preparing to unpack .../install-info_5.2.0.dfsg.1-2_armhf.deb ...
Unpacking install-info (5.2.0.dfsg.1-2) ...
Setting up install-info (5.2.0.dfsg.1-2) ...
Selecting previously unselected package libpipeline1:armhf.
(Reading database ... 11647 files and directories currently installed.)
Preparing to unpack .../libpipeline1_1.2.6-2_armhf.deb ...
Unpacking libpipeline1:armhf (1.2.6-2) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../groff-base_1.22.2-5_armhf.deb ...
Unpacking groff-base (1.22.2-5) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../bsdmainutils_9.0.5_armhf.deb ...
Unpacking bsdmainutils (9.0.5) ...
Selecting previously unselected package man-db.
Preparing to unpack .../man-db_2.6.6-1_armhf.deb ...
Unpacking man-db (2.6.6-1) ...
Selecting previously unselected package libasprintf0c2:armhf.
Preparing to unpack .../libasprintf0c2_0.18.3.2-1_armhf.deb ...
Unpacking libasprintf0c2:armhf (0.18.3.2-1) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../libmagic1_1%3a5.17-0.1_armhf.deb ...
Unpacking libmagic1:armhf (1:5.17-0.1) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../libxml2_2.9.1+dfsg1-3_armhf.deb ...
Unpacking libxml2:armhf (2.9.1+dfsg1-3) ...
Selecting previously unselected package libffi6:armhf.
Preparing to unpack .../libffi6_3.0.13-12_armhf.deb ...
Unpacking libffi6:armhf (3.0.13-12) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../libglib2.0-0_2.38.2-5_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.38.2-5) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../libcroco3_0.6.8-2_armhf.deb ...
Unpacking libcroco3:armhf (0.6.8-2) ...
Selecting previously unselected package libunistring0:armhf.
Preparing to unpack .../libunistring0_0.9.3-5_armhf.deb ...
Unpacking libunistring0:armhf (0.9.3-5) ...
Selecting previously unselected package bc.
Preparing to unpack .../bc_1.06.95-8_armhf.deb ...
Unpacking bc (1.06.95-8) ...
Selecting previously unselected package file.
Preparing to unpack .../file_1%3a5.17-0.1_armhf.deb ...
Unpacking file (1:5.17-0.1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../gettext-base_0.18.3.2-1_armhf.deb ...
Unpacking gettext-base (0.18.3.2-1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../gettext_0.18.3.2-1_armhf.deb ...
Unpacking gettext (0.18.3.2-1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../intltool-debian_0.35.0+20060710.1_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.1) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../po-debconf_1.0.16+nmu2_all.deb ...
Unpacking po-debconf (1.0.16+nmu2) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../debhelper_9.20131227_all.deb ...
Unpacking debhelper (9.20131227) ...
Selecting previously unselected package help2man.
Preparing to unpack .../help2man_1.44.1_armhf.deb ...
Unpacking help2man (1.44.1) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../zlib1g-dev_1%3a1.2.8.dfsg-1_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.8.dfsg-1) ...
Selecting previously unselected package sbuild-build-depends-mapsembler2-dummy.
Preparing to unpack .../sbuild-build-depends-mapsembler2-dummy.deb ...
Unpacking sbuild-build-depends-mapsembler2-dummy (0.invalid.0) ...
Processing triggers for install-info (5.2.0.dfsg.1-2) ...
Setting up libpipeline1:armhf (1.2.6-2) ...
Setting up groff-base (1.22.2-5) ...
Setting up bsdmainutils (9.0.5) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up man-db (2.6.6-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libasprintf0c2:armhf (0.18.3.2-1) ...
Setting up libmagic1:armhf (1:5.17-0.1) ...
Setting up libxml2:armhf (2.9.1+dfsg1-3) ...
Setting up libffi6:armhf (3.0.13-12) ...
Setting up libglib2.0-0:armhf (2.38.2-5) ...
No schema files found: doing nothing.
Setting up libcroco3:armhf (0.6.8-2) ...
Setting up libunistring0:armhf (0.9.3-5) ...
Setting up bc (1.06.95-8) ...
Setting up file (1:5.17-0.1) ...
Setting up gettext-base (0.18.3.2-1) ...
Setting up gettext (0.18.3.2-1) ...
Setting up intltool-debian (0.35.0+20060710.1) ...
Setting up po-debconf (1.0.16+nmu2) ...
Setting up debhelper (9.20131227) ...
Setting up help2man (1.44.1) ...
Setting up zlib1g-dev:armhf (1:1.2.8.dfsg-1) ...
Setting up sbuild-build-depends-mapsembler2-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.17-97) ...

┌──────────────────────────────────────────────────────────────────────────────┐
│ Build environment                                                            │
└──────────────────────────────────────────────────────────────────────────────┘

Kernel: Linux 3.13-trunk-armmp armhf (armv7l)
Toolchain package versions: binutils_2.24-3 dpkg-dev_1.17.6+rpi1 g++-4.8_4.8.2-16 gcc-4.8_4.8.2-16 libc6-dev_2.17-97 libstdc++-4.8-dev_4.8.2-16 libstdc++6_4.8.2-16 linux-libc-dev_3.12.6-2+rpi1
Package versions: apt_0.9.15.2 base-files_7.2+rpi1 base-passwd_3.5.28 bash_4.2+dfsg-1 bc_1.06.95-8 binutils_2.24-3 bsdmainutils_9.0.5 bsdutils_1:2.20.1-5.6 build-essential_11.6 bzip2_1.0.6-5 coreutils_8.21-1 cpio_2.11+dfsg-1 cpp_4:4.8.2-2 cpp-4.8_4.8.2-16 dash_0.5.7-4 debconf_1.5.52 debconf-i18n_1.5.52 debfoster_2.7-1.2 debhelper_9.20131227 debianutils_4.4 diffutils_1:3.3-1 dpkg_1.17.6+rpi1 dpkg-dev_1.17.6+rpi1 e2fslibs_1.42.9-3 e2fsprogs_1.42.9-3 fakeroot_1.18.4-2 file_1:5.17-0.1 findutils_4.4.2-7 g++_4:4.8.2-2 g++-4.8_4.8.2-16 gcc_4:4.8.2-2 gcc-4.5-base_4.5.3-12+rpi1 gcc-4.6-base_4.6.4-5+rpi1 gcc-4.7-base_4.7.3-10+rpi1 gcc-4.8_4.8.2-16 gcc-4.8-base_4.8.2-16 gettext_0.18.3.2-1 gettext-base_0.18.3.2-1 gnupg_1.4.16-1.1 gpgv_1.4.16-1.1 grep_2.16-1 groff-base_1.22.2-5 gzip_1.6-3 help2man_1.44.1 hostname_3.15 initramfs-tools_0.115 initscripts_2.88dsf-51 insserv_1.14.0-5 install-info_5.2.0.dfsg.1-2 intltool-debian_0.35.0+20060710.1 klibc-utils_2.0.2-1+rpi1 kmod_16-2 libacl1_2.2.52-1 libapt-pkg4.12_0.9.15.2 libasan0_4.8.2-16 libasprintf0c2_0.18.3.2-1 libatomic1_4.8.2-16 libattr1_1:2.4.47-1 libaudit-common_1:2.3.3-4 libaudit1_1:2.3.3-4 libblkid1_2.20.1-5.6 libbz2-1.0_1.0.6-5 libc-bin_2.17-97 libc-dev-bin_2.17-97 libc6_2.17-97 libc6-dev_2.17-97 libcap2_1:2.22-1.2 libcloog-isl4_0.18.1-3 libcomerr2_1.42.9-3 libcroco3_0.6.8-2 libdb5.1_5.1.29-6 libdb5.3_5.3.28-3 libdbus-1-3_1.8.0-1 libdpkg-perl_1.17.6+rpi1 libffi6_3.0.13-12 libgc1c2_1:7.2d-6 libgcc-4.8-dev_4.8.2-16 libgcc1_1:4.8.2-16 libgdbm3_1.8.3-12 libglib2.0-0_2.38.2-5 libgmp10_2:5.1.3+dfsg-1 libgomp1_4.8.2-16 libisl10_0.12.2-1 libklibc_2.0.2-1+rpi1 libkmod2_16-2 liblocale-gettext-perl_1.05-7+b3 liblzma5_5.1.1alpha+20120614-2 libmagic1_1:5.17-0.1 libmount1_2.20.1-5.6 libmpc3_1.0.1-1 libmpfr4_3.1.2-1 libncurses5_5.9+20140118-1 libncursesw5_5.9+20140118-1 libnih-dbus1_1.0.3-4.2 libnih1_1.0.3-4.2 libpam-modules_1.1.8-2 libpam-modules-bin_1.1.8-2 libpam-runtime_1.1.8-2 libpam0g_1.1.8-2 libpcre3_1:8.31-2 libpipeline1_1.2.6-2 libprocps0_1:3.3.4-2 libprocps3_1:3.3.9-2 libreadline6_6.2+dfsg-0.1 libselinux1_2.2.2-1 libsemanage-common_2.2-1 libsemanage1_2.2-1 libsepol1_2.2-1 libslang2_2.2.4-16 libss2_1.42.9-3 libstdc++-4.8-dev_4.8.2-16 libstdc++6_4.8.2-16 libtext-charwidth-perl_0.04-7+b3 libtext-iconv-perl_1.7-5+b3 libtext-wrapi18n-perl_0.06-7 libtimedate-perl_2.3000-1 libtinfo5_5.9+20140118-1 libudev1_204-7 libunistring0_0.9.3-5 libusb-0.1-4_2:0.1.12-23.3 libustr-1.0-1_1.0.4-3 libuuid1_2.20.1-5.6 libxml2_2.9.1+dfsg1-3 linux-libc-dev_3.12.6-2+rpi1 login_1:4.1.5.1-1 lsb-base_4.1+Debian12+rpi1 make_3.81-8.3 makedev_2.3.1-93 man-db_2.6.6-1 mawk_1.3.3-17 mount_2.20.1-5.6 mountall_2.52 multiarch-support_2.17-97 nano_2.2.6-1 ncurses-base_5.9+20140118-1 ncurses-bin_5.9+20140118-1 passwd_1:4.1.5.1-1 patch_2.7.1-4 perl_5.18.2-2 perl-base_5.18.2-2 perl-modules_5.18.2-2 plymouth_0.8.8-6+deb8u3 po-debconf_1.0.16+nmu2 procps_1:3.3.9-2 raspbian-archive-keyring_20120528.2 readline-common_6.2+dfsg-0.1 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-mapsembler2-dummy_0.invalid.0 sed_4.2.2-4 sensible-utils_0.0.9 sysv-rc_2.88dsf-51 sysvinit_2.88dsf-51 sysvinit-core_2.88dsf-51 sysvinit-utils_2.88dsf-51 tar_1.27.1-1 tzdata_2013i-1 udev_204-7 util-linux_2.20.1-5.6 xz-utils_5.1.1alpha+20120614-2 zlib1g_1:1.2.8.dfsg-1 zlib1g-dev_1:1.2.8.dfsg-1

┌──────────────────────────────────────────────────────────────────────────────┐
│ Build                                                                        │
└──────────────────────────────────────────────────────────────────────────────┘


Unpack source
─────────────

gpgv: keyblock resource `/sbuild-nonexistent/.gnupg/trustedkeys.gpg': file open error
gpgv: Signature made Fri Feb 21 14:41:32 2014 UTC using RSA key ID 326D8438
gpgv: Can't check signature: public key not found
dpkg-source: warning: failed to verify signature on ./mapsembler2_2.0.31-1.dsc
dpkg-source: info: extracting mapsembler2 in mapsembler2-2.0.31
dpkg-source: info: unpacking mapsembler2_2.0.31.orig.tar.xz
dpkg-source: info: unpacking mapsembler2_2.0.31-1.debian.tar.xz
dpkg-source: info: applying fix_makefile

Check disc space
────────────────

Sufficient free space for build

User Environment
────────────────

APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LANG=en_GB.UTF-8
LC_ALL=POSIX
LOGNAME=root
MAIL=/var/mail/root
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
PWD=/root
SCHROOT_ALIAS_NAME=jessie-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=jessie-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=jessie-staging-armhf-sbuild-ecaa07a1-0128-474b-a73d-507aa4346254
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
SHLVL=1
SSH_CLIENT=172.17.0.6 34329 22
SSH_CONNECTION=172.17.0.6 34329 172.17.2.4 22
SSH_TTY=/dev/pts/0
TERM=xterm
USER=buildd
_=/etc/init.d/buildd

dpkg-buildpackage
─────────────────

dpkg-buildpackage: source package mapsembler2
dpkg-buildpackage: source version 2.0.31-1
dpkg-buildpackage: source distribution unstable
 dpkg-source --before-build mapsembler2-2.0.31
dpkg-buildpackage: host architecture armhf
 fakeroot debian/rules clean
dh clean
   dh_testdir
   dh_auto_clean
   debian/rules override_dh_clean
make[1]: Entering directory `/«PKGBUILDDIR»'
cd mapsembler2 && make clean
make[2]: Entering directory `/«PKGBUILDDIR»/mapsembler2'
rm -rf mapsembler *.o ../minia/*.o read_coherence_mapsembler/*.o
make[2]: Leaving directory `/«PKGBUILDDIR»/mapsembler2'
rm -f mapsembler2/mapsembler
rm -f mapsembler.1
dh_clean
make[1]: Leaving directory `/«PKGBUILDDIR»'
 debian/rules build-arch
dh build-arch
   dh_testdir -a
   dh_auto_configure -a
   debian/rules override_dh_auto_build
make[1]: Entering directory `/«PKGBUILDDIR»'
dh_auto_build
cd mapsembler2 && make
make[2]: Entering directory `/«PKGBUILDDIR»/mapsembler2'
g++ -lz -o ../minia/Pool.o -c ../minia/Pool.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/Bank.o -c ../minia/Bank.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/Bank.cpp: In member function 'int KmersBuffer::readkmers()':
../minia/Bank.cpp:915:65: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
         fread(buffer,sizeof( char),block_size, binary_read_file); // read a block of reads into the buffer
                                                                 ^
g++ -lz -o ../minia/Bloom.o -c ../minia/Bloom.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/Bloom.cpp: In member function 'void Bloom::load(char*)':
../minia/Bloom.cpp:257:56: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
  fread(blooma, sizeof(unsigned char), nchar, file_data);
                                                        ^
g++ -lz -o ../minia/Hash16.o -c ../minia/Hash16.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/Terminator.o -c ../minia/Terminator.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/Kmer.o -c ../minia/Kmer.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/Traversal.o -c ../minia/Traversal.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/LinearCounter.o -c ../minia/LinearCounter.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/Set.o -c ../minia/Set.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/Set.cpp: In member function 'void AssocSet::print_total_size()':
../minia/Set.cpp:131:48: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
     printf("Assoc set size: %li\n",liste.size());
                                                ^
../minia/Set.cpp:132:103: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
     printf("Assoc set capacity: listekmer %li  liste val%li\n",liste.capacity(),liste_value.capacity());
                                                                                                       ^
../minia/Set.cpp:132:103: warning: format '%li' expects argument of type 'long int', but argument 3 has type 'std::vector<short unsigned int>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp:135:11: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
           );
           ^
../minia/Set.cpp:135:11: warning: format '%li' expects argument of type 'long int', but argument 3 has type 'unsigned int' [-Wformat=]
../minia/Set.cpp:135:11: warning: format '%li' expects argument of type 'long int', but argument 4 has type 'std::vector<short unsigned int>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp:135:11: warning: format '%li' expects argument of type 'long int', but argument 5 has type 'unsigned int' [-Wformat=]
../minia/Set.cpp:135:11: warning: format '%li' expects argument of type 'long int', but argument 6 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp: In member function 'void AssocPairedSet::print_total_size()':
../minia/Set.cpp:295:55: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
     printf("Assoc paired set size: %li\n",liste.size());
                                                       ^
../minia/Set.cpp:296:110: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
     printf("Assoc paired set capacity: listekmer %li  liste val%li\n",liste.capacity(),liste_value.capacity());
                                                                                                              ^
../minia/Set.cpp:296:110: warning: format '%li' expects argument of type 'long int', but argument 3 has type 'std::vector<pair_nt_kmer>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp:299:12: warning: format '%li' expects argument of type 'long int', but argument 2 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
            );
            ^
../minia/Set.cpp:299:12: warning: format '%li' expects argument of type 'long int', but argument 3 has type 'unsigned int' [-Wformat=]
../minia/Set.cpp:299:12: warning: format '%li' expects argument of type 'long int', but argument 4 has type 'std::vector<pair_nt_kmer>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp:299:12: warning: format '%li' expects argument of type 'long int', but argument 5 has type 'unsigned int' [-Wformat=]
../minia/Set.cpp:299:12: warning: format '%li' expects argument of type 'long int', but argument 6 has type 'std::vector<long long unsigned int>::size_type {aka unsigned int}' [-Wformat=]
../minia/Set.cpp: In member function 'void AssocPairedSet::load(char*)':
../minia/Set.cpp:287:82: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
     fread(&liste_value[0], sizeof(pair_nt_kmer_t), liste_value.size(), file_data);
                                                                                  ^
g++ -lz -o ../minia/Utils.o -c ../minia/Utils.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/Utils.cpp: In function 'uint64_t extrapolate_distinct_kmers_wrapped(long unsigned int, Bank*)':
../minia/Utils.cpp:431:96: warning: format '%d' expects argument of type 'int', but argument 2 has type 'long unsigned int' [-Wformat=]
         printf("Inaccurate estimation, restarting with %d MB RAM\n",(2*nbytes_memory)/1024/1024);
                                                                                                ^
../minia/Utils.cpp: In instantiation of 'Bloom* bloom_create_bloo1(T*, bool) [with T = BloomCpt]':
../minia/Utils.cpp:159:85:   required from here
../minia/Utils.cpp:124:81: warning: format '%lli' expects argument of type 'long long int', but argument 2 has type 'off_t {aka long int}' [-Wformat=]
         printf("nelem %lli nbits %g \n",SolidKmers->nb_elements(),NBITS_PER_KMER);
                                                                                 ^
../minia/Utils.cpp: In function 'void end_kmer_count_partition(bool, Hash16*)':
../minia/Utils.cpp:179:42: warning: ignoring return value of 'int ftruncate(int, __off_t)', declared with attribute warn_unused_result [-Wunused-result]
     ftruncate(fileno(F_kmercpt_write), 0); //erase previous file 
                                          ^
../minia/Utils.cpp:191:54: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
         fread(&cptk, sizeof(cptk), 1, F_kmercpt_read);
                                                      ^
../minia/Utils.cpp:217:45: warning: ignoring return value of 'int ftruncate(int, __off_t)', declared with attribute warn_unused_result [-Wunused-result]
         ftruncate(fileno(F_kmercpt_read), 0); //erase previous file 
                                             ^
g++ -lz -o ../minia/SortingCount.o -c ../minia/SortingCount.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/SortingCount.cpp: In function 'void sorting_count(Bank*, char*, int, int, bool, int)':
../minia/SortingCount.cpp:51:50: warning: ignoring return value of 'char* getcwd(char*, size_t)', declared with attribute warn_unused_result [-Wunused-result]
         getcwd(current_path,sizeof(current_path));
                                                  ^
../minia/SortingCount.cpp:226:52: warning: ignoring return value of 'int system(const char*)', declared with attribute warn_unused_result [-Wunused-result]
         system("echo 3 > /proc/sys/vm/drop_caches");
                                                    ^
../minia/SortingCount.cpp:449:56: warning: ignoring return value of 'int system(const char*)', declared with attribute warn_unused_result [-Wunused-result]
             system("echo 3 > /proc/sys/vm/drop_caches");
                                                        ^
g++ -lz -o ../minia/Debloom.o -c ../minia/Debloom.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/Debloom.cpp: In function 'void end_debloom_partition(bool)':
../minia/Debloom.cpp:24:39: warning: ignoring return value of 'int ftruncate(int, __off_t)', declared with attribute warn_unused_result [-Wunused-result]
  ftruncate(fileno(F_debloom_write), 0); //erase previous file 
                                       ^
g++ -lz -o ../minia/OAHash.o -c ../minia/OAHash.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Kmer_for_kissnp2.o -c Kmer_for_kissnp2.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Extension.o -c Extension.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Extension_Bank.o -c Extension_Bank.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Starter.o -c Starter.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o commons.o -c commons.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o read_coherence_mapsembler/libchash.o -c read_coherence_mapsembler/libchash.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
read_coherence_mapsembler/libchash.cpp: In function 'HTItem* HashFind(HashTable*, u_long)':
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:226:7: note: in expansion of macro 'READ_UL'
       READ_UL((ht)->fpData, cchData);                                         \
       ^
read_coherence_mapsembler/libchash.cpp:1227:3: note: in expansion of macro 'LOAD_AND_RETURN'
   LOAD_AND_RETURN(ht, Find(ht, KEY_TRUNC(ht, key), NULL));
   ^
read_coherence_mapsembler/libchash.cpp: In function 'HTItem* HashFindLast(HashTable*)':
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:226:7: note: in expansion of macro 'READ_UL'
       READ_UL((ht)->fpData, cchData);                                         \
       ^
read_coherence_mapsembler/libchash.cpp:1232:4: note: in expansion of macro 'LOAD_AND_RETURN'
    LOAD_AND_RETURN(ht, ht->posLastFind);
    ^
read_coherence_mapsembler/libchash.cpp: In function 'HTItem* HashFirstBucket(HashTable*)':
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:226:7: note: in expansion of macro 'READ_UL'
       READ_UL((ht)->fpData, cchData);                                         \
       ^
read_coherence_mapsembler/libchash.cpp:1296:3: note: in expansion of macro 'LOAD_AND_RETURN'
   LOAD_AND_RETURN(ht, retval);
   ^
read_coherence_mapsembler/libchash.cpp: In function 'HTItem* HashNextBucket(HashTable*)':
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:226:7: note: in expansion of macro 'READ_UL'
       READ_UL((ht)->fpData, cchData);                                         \
       ^
read_coherence_mapsembler/libchash.cpp:1306:3: note: in expansion of macro 'LOAD_AND_RETURN'
   LOAD_AND_RETURN(ht, retval);
   ^
read_coherence_mapsembler/libchash.cpp: In function 'HashTable* HashDoLoad(FILE*, char* (*)(FILE*, int), HashTable*)':
read_coherence_mapsembler/libchash.cpp:1413:31: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
    fread(szMagicKey, 1, 4, fp);
                               ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:1422:4: note: in expansion of macro 'READ_UL'
    READ_UL(fp, ht->cchKey);
    ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:1423:4: note: in expansion of macro 'READ_UL'
    READ_UL(fp, ht->cItems);
    ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:1424:4: note: in expansion of macro 'READ_UL'
    READ_UL(fp, ht->cDeletedItems);
    ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:1427:4: note: in expansion of macro 'READ_UL'
    READ_UL(fp, cchKey);
    ^
read_coherence_mapsembler/libchash.cpp:1429:34: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
    fread(rgchKeys, 1, cchKey, fp);
                                  ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:1434:7: note: in expansion of macro 'READ_UL'
       READ_UL(fp, bck->data);        /* all we need if dataRead is NULL */
       ^
read_coherence_mapsembler/libchash.cpp: In function 'u_long SparseRead(FILE*, SparseBin**)':
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:628:4: note: in expansion of macro 'READ_UL'
    READ_UL(fp, cBuckets);                /* actually, cBuckets is stored */
    ^
read_coherence_mapsembler/libchash.cpp:199:40: warning: ignoring return value of 'size_t fread(void*, size_t, size_t, FILE*)', declared with attribute warn_unused_result [-Wunused-result]
       fread(&_ul, sizeof(_ul), 1, (fp));   \
                                        ^
read_coherence_mapsembler/libchash.cpp:633:3: note: in expansion of macro 'READ_UL'
   READ_UL(fp, (*pbinSparse)[i].bmOccupied[j]);
   ^
g++ -lz -o read_coherence_mapsembler/couple.o -c read_coherence_mapsembler/couple.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o read_coherence_mapsembler/misc_tools.o -c read_coherence_mapsembler/misc_tools.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o ../minia/GraphOutput.o -c ../minia/GraphOutput.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
../minia/GraphOutput.cpp: In constructor 'GraphOutput::GraphOutput(std::string, int, std::id_els)':
../minia/GraphOutput.cpp:69:117: warning: format '%d' expects argument of type 'int', but argument 3 has type 'long int' [-Wformat=]
   printf("graph_format=%d first_id_nodes=%d first_id_edges=%d\n", graph_format, first_id_els.node, first_id_els.edge);
                                                                                                                     ^
../minia/GraphOutput.cpp:69:117: warning: format '%d' expects argument of type 'int', but argument 4 has type 'long int' [-Wformat=]
g++ -lz -o read_coherence_mapsembler/read_groups.o -c read_coherence_mapsembler/read_groups.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o read_coherence_mapsembler/consensus_common.o -c read_coherence_mapsembler/consensus_common.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o read_coherence_mapsembler/list.o -c read_coherence_mapsembler/list.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o read_coherence_mapsembler/read_coherence.o -c read_coherence_mapsembler/read_coherence.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
read_coherence_mapsembler/read_coherence.cpp: In function 'int check_fragment_coverage(group_t, group_info*, int, int)':
read_coherence_mapsembler/read_coherence.cpp:250:40: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                            min_coverage);
                                        ^
read_coherence_mapsembler/read_coherence.cpp: In function 'char** read_coherent_homologs(hash_t, const char*, int, int, int, int, int*)':
read_coherence_mapsembler/read_coherence.cpp:524:50: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                current_read_group);
                                                  ^
read_coherence_mapsembler/read_coherence.cpp:540:70: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                current_read_group, position_fragment );
                                                                      ^
read_coherence_mapsembler/read_coherence.cpp:569:58: warning: format '%X' expects argument of type 'unsigned int', but argument 4 has type 'group_t {aka list*}' [-Wformat=]
                                        current_read_group);
                                                          ^
read_coherence_mapsembler/read_coherence.cpp:656:61: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                    group_fork_up_to_position);
                                                             ^
read_coherence_mapsembler/read_coherence.cpp:656:61: warning: format '%X' expects argument of type 'unsigned int', but argument 5 has type 'group_t {aka list*}' [-Wformat=]
read_coherence_mapsembler/read_coherence.cpp:774:79: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                                other_read_group_info->nb_reads);
                                                                               ^
read_coherence_mapsembler/read_coherence.cpp:774:79: warning: format '%X' expects argument of type 'unsigned int', but argument 4 has type 'group_t {aka list*}' [-Wformat=]
read_coherence_mapsembler/read_coherence.cpp:814:52: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                                : "");
                                                    ^
read_coherence_mapsembler/read_coherence.cpp:814:52: warning: format '%X' expects argument of type 'unsigned int', but argument 4 has type 'group_t {aka list*}' [-Wformat=]
read_coherence_mapsembler/read_coherence.cpp:832:36: warning: format '%lX' expects argument of type 'long unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                : "");
                                    ^
read_coherence_mapsembler/read_coherence.cpp:874:63: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                                current_read, position_fragment);
                                                               ^
read_coherence_mapsembler/read_coherence.cpp:887:100: warning: format '%x' expects argument of type 'unsigned int', but argument 2 has type 'long unsigned int' [-Wformat=]
                                 printf("can't append group %x to groups\n",(unsigned long)new_group);
                                                                                                    ^
read_coherence_mapsembler/read_coherence.cpp:939:88: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                        current_read_group, fragment, current_read_group_info->consensus);
                                                                                        ^
read_coherence_mapsembler/read_coherence.cpp:979:53: warning: format '%X' expects argument of type 'unsigned int', but argument 3 has type 'group_t {aka list*}' [-Wformat=]
                         substarters[*nb_consensuses]);
                                                     ^
read_coherence_mapsembler/read_coherence.cpp:992:69: warning: format '%X' expects argument of type 'unsigned int', but argument 3 has type 'group_t {aka list*}' [-Wformat=]
                         current_read_group_info->consensus, fragment);
                                                                     ^
read_coherence_mapsembler/read_coherence.cpp:1013:66: warning: format '%X' expects argument of type 'unsigned int', but argument 2 has type 'group_t {aka list*}' [-Wformat=]
                            fragment, substarters[*nb_consensuses]);
                                                                  ^
g++ -lz -o read_coherence_mapsembler/interface_libchash.o -c read_coherence_mapsembler/interface_libchash.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Starter_Bank.o -c Starter_Bank.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o IterativeExtensions.o -c IterativeExtensions.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Fragment_Bank.o -c Fragment_Bank.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o BooleanVector.o -c BooleanVector.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -lz -o Fragment.o -c Fragment.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2
g++ -o mapsembler ../minia/Pool.o ../minia/Bank.o ../minia/Bloom.o ../minia/Hash16.o ../minia/Terminator.o ../minia/Kmer.o ../minia/Traversal.o ../minia/LinearCounter.o ../minia/Set.o ../minia/Utils.o ../minia/SortingCount.o ../minia/Debloom.o ../minia/OAHash.o Kmer_for_kissnp2.o Extension.o Extension_Bank.o Starter.o commons.o read_coherence_mapsembler/libchash.o read_coherence_mapsembler/couple.o read_coherence_mapsembler/misc_tools.o ../minia/GraphOutput.o read_coherence_mapsembler/read_groups.o read_coherence_mapsembler/consensus_common.o read_coherence_mapsembler/list.o read_coherence_mapsembler/read_coherence.o read_coherence_mapsembler/interface_libchash.o Starter_Bank.o IterativeExtensions.o Fragment_Bank.o BooleanVector.o Fragment.o mapsembler.cpp -g -lz -DMINIA_IS_IN_PARENT_FOLDER -g -O2 -fstack-protector --param=ssp-buffer-size=4 -Wformat -Werror=format-security -D_FORTIFY_SOURCE=2  -Wl,-z,relro
mapsembler.cpp:96:5: warning: this decimal constant is unsigned only in ISO C90 [enabled by default]
     genome_size=3000000000;
     ^
mapsembler.cpp: In function 'int main(int, char**)':
mapsembler.cpp:320:46: warning: format '%lx' expects argument of type 'long unsigned int', but argument 2 has type 'BinaryBank*' [-Wformat=]
         printf("%lx Solid kmer\n", SolidKmers);
                                              ^
make[2]: Leaving directory `/«PKGBUILDDIR»/mapsembler2'
make[1]: Leaving directory `/«PKGBUILDDIR»'
   dh_auto_test -a
 fakeroot debian/rules binary-arch
dh binary-arch
   dh_testroot -a
   dh_prep -a
   dh_auto_install -a
   debian/rules override_dh_install
make[1]: Entering directory `/«PKGBUILDDIR»'
help2man --help-option=-h --no-discard-stderr --version-string=2.0.31 ./mapsembler2/mapsembler > mapsembler.1
dh_install
make[1]: Leaving directory `/«PKGBUILDDIR»'
   dh_installdocs -a
   dh_installchangelogs -a
   dh_installman -a
   dh_perl -a
   dh_link -a
   dh_compress -a
   dh_fixperms -a
   dh_strip -a
   dh_makeshlibs -a
   dh_shlibdeps -a
   dh_installdeb -a
   dh_gencontrol -a
dpkg-gencontrol: warning: File::FcntlLock not available; using flock which is not NFS-safe
   dh_md5sums -a
   dh_builddeb -a
dpkg-deb: building package `mapsembler2' in `../mapsembler2_2.0.31-1_armhf.deb'.
 dpkg-genchanges -B -mRaspbian wandboard test autobuilder <root@raspbian.org> >../mapsembler2_2.0.31-1_armhf.changes
dpkg-genchanges: arch-specific upload - not including arch-independent packages
dpkg-genchanges: binary-only upload - not including any source code
 dpkg-source --after-build mapsembler2-2.0.31
dpkg-buildpackage: binary-only upload (no source included)
────────────────────────────────────────────────────────────────────────────────
Build finished at 20140304-0544

Finished
────────

I: Built successfully

┌──────────────────────────────────────────────────────────────────────────────┐
│ Changes                                                                      │
└──────────────────────────────────────────────────────────────────────────────┘


mapsembler2_2.0.31-1_armhf.changes:
───────────────────────────────────

Format: 1.8
Date: Fri, 21 Feb 2014 15:13:29 +0100
Source: mapsembler2
Binary: mapsembler2
Architecture: armhf
Version: 2.0.31-1
Distribution: jessie-staging
Urgency: low
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Olivier Sallou <osallou@debian.org>
Description: 
 mapsembler2 - bioinformatics targeted assembly software
Changes: 
 mapsembler2 (2.0.31-1) unstable; urgency=low
 .
   * New upstream release
Checksums-Sha1: 
 c3c02ddf24956e946d37cb7dc6116adb11a11b70 327896 mapsembler2_2.0.31-1_armhf.deb
Checksums-Sha256: 
 5c371267a8bed9ed63f612177bdc5d00d64731baac9abcd0ec88ef5fa2493ba0 327896 mapsembler2_2.0.31-1_armhf.deb
Files: 
 22cf9e04c2e78737a43a865e3722754e 327896 science optional mapsembler2_2.0.31-1_armhf.deb

┌──────────────────────────────────────────────────────────────────────────────┐
│ Package contents                                                             │
└──────────────────────────────────────────────────────────────────────────────┘


mapsembler2_2.0.31-1_armhf.deb
──────────────────────────────

 new debian package, version 2.0.
 size 327896 bytes: control archive=1620 bytes.
    1374 bytes,    27 lines      control              
    1765 bytes,    17 lines      md5sums              
 Package: mapsembler2
 Version: 2.0.31-1
 Architecture: armhf
 Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
 Installed-Size: 442
 Depends: libc6 (>= 2.4), libgcc1 (>= 1:4.4.0), libstdc++6 (>= 4.4.0), zlib1g (>= 1:1.2.3.4), bc
 Section: science
 Priority: optional
 Homepage: http://colibread.inria.fr/mapsembler2/
 Description: bioinformatics targeted assembly software
  Mapsembler2 is a targeted assembly software.
  It takes as input a set of NGS raw reads (fasta or fastq, gzipped or not)
  and a set of input sequences (starters).
  .
  It first determines if each starter is read-coherent, e.g. whether reads
  confirm the presence of each starter in the original sequence.
  Then for each read-coherent starter, Mapsembler2 outputs its sequence
  neighborhood as a linear sequence or as a graph, depending on the user choice.
  .
  Mapsembler2 may be used for (not limited to):
   - Validate an assembled sequence (input as starter), e.g. from a de
     Bruijn graph assembly where read-coherence was not enforced.
   - Checks if a gene (input as starter) has an homolog in a set of reads
   - Checks if a known enzyme is present in a metagenomic NGS read set.
   - Enrich unmappable reads by extending them, possibly making them mappable
   - Checks what happens at the extremities of a contig
   - Remove contaminants or symbiont reads from a read set

drwxr-xr-x root/root         0 2014-03-04 05:43 ./
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/bin/
-rwxr-xr-x root/root    178224 2014-03-04 05:43 ./usr/bin/mapsembler
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/doc/
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/doc/mapsembler2/
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/doc/mapsembler2/sample_example/
-rw-r--r-- root/root        51 2013-03-29 08:37 ./usr/share/doc/mapsembler2/sample_example/fragments.fa
-rw-r--r-- root/root    179834 2013-03-29 08:37 ./usr/share/doc/mapsembler2/sample_example/reads.fa.gz
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/doc/mapsembler2/sample_example_results/
-rw-r--r-- root/root      1715 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/trashmepleaseTCCCTCTTTGCTACCGTTTACTT
-rw-r--r-- root/root      1410 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/trashmepleaseAGAGGGATCTGTTATAGATCAAA
-rw-r--r-- root/root      1120 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/sample_example_test_k24_c10_d40_g400000000_t3.false_positive_kmers
-rw-r--r-- root/root       320 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/sample_example_test_k24_c10_d40_g400000000_t3.debloom2
-rw-r--r-- root/root      6242 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/sample_example_test_k24_c10_d40_g400000000_t3.solid_kmers_binary.gz
-rw-r--r-- root/root     43489 2012-12-13 13:41 ./usr/share/doc/mapsembler2/sample_example_results/sample_example_test_k24_c10_d40_g400000000_t3.reads_binary.gz
-rw-r--r-- root/root      8895 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/sample_example_test_k24_c10_d40_g400000000_t3.debloom.gz
-rw-r--r-- root/root      1375 2012-12-10 13:56 ./usr/share/doc/mapsembler2/sample_example_results/res_mapsembler.xgmml.gz
-rw-r--r-- root/root      1468 2013-04-08 10:42 ./usr/share/doc/mapsembler2/sample_example_results/res_mapsembler.json.gz
-rw-r--r-- root/root       167 2013-04-08 11:06 ./usr/share/doc/mapsembler2/README
-rw-r--r-- root/root       219 2014-02-01 14:13 ./usr/share/doc/mapsembler2/README.Debian
-rw-r--r-- root/root     25329 2014-02-21 14:20 ./usr/share/doc/mapsembler2/copyright
-rw-r--r-- root/root       257 2014-02-21 14:40 ./usr/share/doc/mapsembler2/changelog.Debian.gz
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/man/
drwxr-xr-x root/root         0 2014-03-04 05:43 ./usr/share/man/man1/
-rw-r--r-- root/root      1255 2014-03-04 05:43 ./usr/share/man/man1/mapsembler.1.gz


┌──────────────────────────────────────────────────────────────────────────────┐
│ Post Build                                                                   │
└──────────────────────────────────────────────────────────────────────────────┘


┌──────────────────────────────────────────────────────────────────────────────┐
│ Cleanup                                                                      │
└──────────────────────────────────────────────────────────────────────────────┘

Purging /«BUILDDIR»
Not cleaning session: cloned chroot in use

┌──────────────────────────────────────────────────────────────────────────────┐
│ Summary                                                                      │
└──────────────────────────────────────────────────────────────────────────────┘

Build Architecture: armhf
Build-Space: 9928
Build-Time: 246
Distribution: jessie-staging
Host Architecture: armhf
Install-Time: 133
Job: mapsembler2_2.0.31-1
Machine Architecture: armhf
Package: mapsembler2
Package-Time: 435
Source-Version: 2.0.31-1
Space: 9928
Status: successful
Version: 2.0.31-1
────────────────────────────────────────────────────────────────────────────────
Finished at 20140304-0544
Build needed 00:07:15, 9928k disc space