tnseq-transit →
3.2.2-1 →
armhf → 2021-10-15 06:56:17
sbuild (Debian sbuild) 0.71.0 (24 Aug 2016) on testbuildd
+==============================================================================+
| tnseq-transit 3.2.2-1 (armhf) Fri, 15 Oct 2021 06:00:20 +0000 |
+==============================================================================+
Package: tnseq-transit
Version: 3.2.2-1
Source Version: 3.2.2-1
Distribution: bookworm-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf
I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/bookworm-staging-armhf-sbuild-bc7e2ff5-f54e-4d70-a317-08dda081fd1c' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 http://172.17.0.1/private bookworm-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private bookworm-staging/main Sources [12.4 MB]
Get:3 http://172.17.0.1/private bookworm-staging/main armhf Packages [13.4 MB]
Fetched 25.9 MB in 29s (907 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Check APT
---------
Checking available source versions...
Download source files with APT
------------------------------
Reading package lists...
NOTICE: 'tnseq-transit' packaging is maintained in the 'Git' version control system at:
https://salsa.debian.org/med-team/tnseq-transit.git
Please use:
git clone https://salsa.debian.org/med-team/tnseq-transit.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 26.9 MB of source archives.
Get:1 http://172.17.0.1/private bookworm-staging/main tnseq-transit 3.2.2-1 (dsc) [2213 B]
Get:2 http://172.17.0.1/private bookworm-staging/main tnseq-transit 3.2.2-1 (tar) [26.9 MB]
Get:3 http://172.17.0.1/private bookworm-staging/main tnseq-transit 3.2.2-1 (diff) [6184 B]
Fetched 26.9 MB in 8s (3459 kB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/tnseq-transit-mkwiFB/tnseq-transit-3.2.2' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/tnseq-transit-mkwiFB' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install build-essential |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-8n5ATl/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-8n5ATl/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-8n5ATl/gpg/trustdb.gpg: trustdb created
gpg: key 35506D9A48F77B2E: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg: imported: 1
gpg: key 35506D9A48F77B2E: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 35506D9A48F77B2E: secret key imported
gpg: Total number processed: 1
gpg: unchanged: 1
gpg: secret keys read: 1
gpg: secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Packages [434 B]
Fetched 2110 B in 1s (2813 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install core build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following package was automatically installed and is no longer required:
netbase
Use 'apt autoremove' to remove it.
The following NEW packages will be installed:
sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 35 not upgraded.
Need to get 852 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [852 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 852 B in 0s (17.4 kB/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 12484 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (armhf included in any)
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper-compat (= 13), dh-python, python3-dev, python3-setuptools, python3-numpy, python3-scipy, python3-pil, python3-matplotlib, python3-statsmodels, python3-pubsub, bwa
Filtered Build-Depends: debhelper-compat (= 13), dh-python, python3-dev, python3-setuptools, python3-numpy, python3-scipy, python3-pil, python3-matplotlib, python3-statsmodels, python3-pubsub, bwa
dpkg-deb: building package 'sbuild-build-depends-tnseq-transit-dummy' in '/<<BUILDDIR>>/resolver-8n5ATl/apt_archive/sbuild-build-depends-tnseq-transit-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning: sbuild-build-depends-core-dummy sbuild-build-depends-tnseq-transit-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Sources [556 B]
Get:5 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ Packages [640 B]
Fetched 2529 B in 1s (3457 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...
Install tnseq-transit build dependencies (apt-based resolver)
-------------------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following package was automatically installed and is no longer required:
netbase
Use 'apt autoremove' to remove it.
The following additional packages will be installed:
autoconf automake autopoint autotools-dev bsdextrautils bwa debhelper
dh-autoreconf dh-python dh-strip-nondeterminism dwz file fonts-lyx
gcc-11-base gettext gettext-base groff-base intltool-debian
libarchive-zip-perl libasan6 libatomic1 libblas3 libbrotli1 libbsd0 libcc1-0
libdebhelper-perl libdeflate0 libelf1 libexpat1 libexpat1-dev libffi8
libfile-stripnondeterminism-perl libfreetype6 libgcc-s1 libgfortran5
libgomp1 libicu67 libimagequant0 libjbig0 libjpeg62-turbo libjs-jquery
libjs-jquery-ui libjs-sphinxdoc libjs-underscore liblapack3 liblbfgsb0
liblcms2-2 libmagic-mgc libmagic1 libmd0 libmpdec3 libpipeline1 libpng16-16
libpython3-dev libpython3-stdlib libpython3.9 libpython3.9-dev
libpython3.9-minimal libpython3.9-stdlib libsigsegv2 libstdc++6
libsub-override-perl libtiff5 libtool libubsan1 libuchardet0 libwebp6
libwebpdemux2 libwebpmux3 libxau6 libxcb1 libxdmcp6 libxml2 m4 mailcap
man-db media-types mime-support po-debconf python-matplotlib-data python3
python3-cycler python3-dateutil python3-decorator python3-dev
python3-distutils python3-kiwisolver python3-lib2to3 python3-matplotlib
python3-minimal python3-numpy python3-pandas python3-pandas-lib
python3-patsy python3-pil python3-pkg-resources python3-pubsub
python3-pyparsing python3-scipy python3-setuptools python3-six
python3-statsmodels python3-statsmodels-lib python3-tz python3.9
python3.9-dev python3.9-minimal sensible-utils ttf-bitstream-vera zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc samtools dh-make gettext-doc
libasprintf-dev libgettextpo-dev groff libjs-jquery-ui-docs liblcms2-utils
libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less
www-browser libmail-box-perl python3-doc python3-tk python3-venv
python-cycler-doc dvipng ffmpeg ghostscript gir1.2-gtk-3.0 inkscape ipython3
librsvg2-common python-matplotlib-doc python3-cairocffi python3-gi
python3-gi-cairo python3-gobject python3-nose python3-pyqt5 python3-sip
python3-tornado texlive-extra-utils texlive-latex-extra ttf-staypuft
gfortran python-numpy-doc python3-numpy-dbg python3-pytest python-pandas-doc
python-patsy-doc python-pil-doc python3-pil-dbg python-pyparsing-doc
python-scipy-doc python-setuptools-doc python-statsmodels-doc python3.9-venv
python3.9-doc binfmt-support
Recommended packages:
curl | wget | lynx libarchive-cpio-perl javascript-common ca-certificates
libltdl-dev libmail-sendmail-perl python3-tk python3-bottleneck
python3-numexpr python3-odf python3-openpyxl python3-xlwt python3-bs4
python3-html5lib python3-lxml python3-tables python3-jinja2 python3-olefile
python3-joblib python3-colorama python3-cvxopt
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev bsdextrautils bwa debhelper
dh-autoreconf dh-python dh-strip-nondeterminism dwz file fonts-lyx gettext
gettext-base groff-base intltool-debian libarchive-zip-perl libblas3
libbrotli1 libbsd0 libdebhelper-perl libdeflate0 libelf1 libexpat1
libexpat1-dev libffi8 libfile-stripnondeterminism-perl libfreetype6
libgfortran5 libicu67 libimagequant0 libjbig0 libjpeg62-turbo libjs-jquery
libjs-jquery-ui libjs-sphinxdoc libjs-underscore liblapack3 liblbfgsb0
liblcms2-2 libmagic-mgc libmagic1 libmd0 libmpdec3 libpipeline1 libpng16-16
libpython3-dev libpython3-stdlib libpython3.9 libpython3.9-dev
libpython3.9-minimal libpython3.9-stdlib libsigsegv2 libsub-override-perl
libtiff5 libtool libuchardet0 libwebp6 libwebpdemux2 libwebpmux3 libxau6
libxcb1 libxdmcp6 libxml2 m4 mailcap man-db media-types mime-support
po-debconf python-matplotlib-data python3 python3-cycler python3-dateutil
python3-decorator python3-dev python3-distutils python3-kiwisolver
python3-lib2to3 python3-matplotlib python3-minimal python3-numpy
python3-pandas python3-pandas-lib python3-patsy python3-pil
python3-pkg-resources python3-pubsub python3-pyparsing python3-scipy
python3-setuptools python3-six python3-statsmodels python3-statsmodels-lib
python3-tz python3.9 python3.9-dev python3.9-minimal
sbuild-build-depends-tnseq-transit-dummy sensible-utils ttf-bitstream-vera
zlib1g-dev
The following packages will be upgraded:
gcc-11-base libasan6 libatomic1 libcc1-0 libgcc-s1 libgomp1 libstdc++6
libubsan1
8 upgraded, 103 newly installed, 0 to remove and 27 not upgraded.
Need to get 73.5 MB of archives.
After this operation, 280 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-8n5ATl/apt_archive ./ sbuild-build-depends-tnseq-transit-dummy 0.invalid.0 [928 B]
Get:2 http://172.17.0.1/private bookworm-staging/main armhf bsdextrautils armhf 2.37.2-3 [135 kB]
Get:3 http://172.17.0.1/private bookworm-staging/main armhf libasan6 armhf 11.2.0-8+rpi1 [1944 kB]
Get:4 http://172.17.0.1/private bookworm-staging/main armhf libubsan1 armhf 11.2.0-8+rpi1 [797 kB]
Get:5 http://172.17.0.1/private bookworm-staging/main armhf libgomp1 armhf 11.2.0-8+rpi1 [88.1 kB]
Get:6 http://172.17.0.1/private bookworm-staging/main armhf gcc-11-base armhf 11.2.0-8+rpi1 [205 kB]
Get:7 http://172.17.0.1/private bookworm-staging/main armhf libgcc-s1 armhf 11.2.0-8+rpi1 [36.1 kB]
Get:8 http://172.17.0.1/private bookworm-staging/main armhf libcc1-0 armhf 11.2.0-8+rpi1 [37.8 kB]
Get:9 http://172.17.0.1/private bookworm-staging/main armhf libatomic1 armhf 11.2.0-8+rpi1 [8196 B]
Get:10 http://172.17.0.1/private bookworm-staging/main armhf libstdc++6 armhf 11.2.0-8+rpi1 [466 kB]
Get:11 http://172.17.0.1/private bookworm-staging/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB]
Get:12 http://172.17.0.1/private bookworm-staging/main armhf groff-base armhf 1.22.4-7 [793 kB]
Get:13 http://172.17.0.1/private bookworm-staging/main armhf libpipeline1 armhf 1.5.3-1 [29.9 kB]
Get:14 http://172.17.0.1/private bookworm-staging/main armhf man-db armhf 2.9.4-2 [1307 kB]
Get:15 http://172.17.0.1/private bookworm-staging/main armhf libpython3.9-minimal armhf 3.9.7-4+rpi1 [794 kB]
Get:16 http://172.17.0.1/private bookworm-staging/main armhf libexpat1 armhf 2.4.1-2 [80.3 kB]
Get:17 http://172.17.0.1/private bookworm-staging/main armhf python3.9-minimal armhf 3.9.7-4+rpi1 [1632 kB]
Get:18 http://172.17.0.1/private bookworm-staging/main armhf python3-minimal armhf 3.9.2-3 [38.2 kB]
Get:19 http://172.17.0.1/private bookworm-staging/main armhf media-types all 4.0.0 [30.3 kB]
Get:20 http://172.17.0.1/private bookworm-staging/main armhf mailcap all 3.70 [31.8 kB]
Get:21 http://172.17.0.1/private bookworm-staging/main armhf mime-support all 3.66 [10.9 kB]
Get:22 http://172.17.0.1/private bookworm-staging/main armhf libffi8 armhf 3.4.2-2 [21.2 kB]
Get:23 http://172.17.0.1/private bookworm-staging/main armhf libmpdec3 armhf 2.5.1-2+rpi1 [73.5 kB]
Get:24 http://172.17.0.1/private bookworm-staging/main armhf libpython3.9-stdlib armhf 3.9.7-4+rpi1 [1618 kB]
Get:25 http://172.17.0.1/private bookworm-staging/main armhf python3.9 armhf 3.9.7-4+rpi1 [480 kB]
Get:26 http://172.17.0.1/private bookworm-staging/main armhf libpython3-stdlib armhf 3.9.2-3 [21.4 kB]
Get:27 http://172.17.0.1/private bookworm-staging/main armhf python3 armhf 3.9.2-3 [37.9 kB]
Get:28 http://172.17.0.1/private bookworm-staging/main armhf sensible-utils all 0.0.17 [21.5 kB]
Get:29 http://172.17.0.1/private bookworm-staging/main armhf libmagic-mgc armhf 1:5.39-3 [273 kB]
Get:30 http://172.17.0.1/private bookworm-staging/main armhf libmagic1 armhf 1:5.39-3 [117 kB]
Get:31 http://172.17.0.1/private bookworm-staging/main armhf file armhf 1:5.39-3 [68.0 kB]
Get:32 http://172.17.0.1/private bookworm-staging/main armhf gettext-base armhf 0.21-4 [171 kB]
Get:33 http://172.17.0.1/private bookworm-staging/main armhf libsigsegv2 armhf 2.13-1 [34.3 kB]
Get:34 http://172.17.0.1/private bookworm-staging/main armhf m4 armhf 1.4.18-5 [186 kB]
Get:35 http://172.17.0.1/private bookworm-staging/main armhf autoconf all 2.71-2 [343 kB]
Get:36 http://172.17.0.1/private bookworm-staging/main armhf autotools-dev all 20180224.1+nmu1 [77.1 kB]
Get:37 http://172.17.0.1/private bookworm-staging/main armhf automake all 1:1.16.4-2 [819 kB]
Get:38 http://172.17.0.1/private bookworm-staging/main armhf autopoint all 0.21-4 [510 kB]
Get:39 http://172.17.0.1/private bookworm-staging/main armhf bwa armhf 0.7.17-6 [195 kB]
Get:40 http://172.17.0.1/private bookworm-staging/main armhf libdebhelper-perl all 13.5.2 [192 kB]
Get:41 http://172.17.0.1/private bookworm-staging/main armhf libtool all 2.4.6-15 [513 kB]
Get:42 http://172.17.0.1/private bookworm-staging/main armhf dh-autoreconf all 20 [17.1 kB]
Get:43 http://172.17.0.1/private bookworm-staging/main armhf libarchive-zip-perl all 1.68-1 [104 kB]
Get:44 http://172.17.0.1/private bookworm-staging/main armhf libsub-override-perl all 0.09-2 [10.2 kB]
Get:45 http://172.17.0.1/private bookworm-staging/main armhf libfile-stripnondeterminism-perl all 1.12.0-1 [26.3 kB]
Get:46 http://172.17.0.1/private bookworm-staging/main armhf dh-strip-nondeterminism all 1.12.0-1 [15.4 kB]
Get:47 http://172.17.0.1/private bookworm-staging/main armhf libelf1 armhf 0.185-2 [168 kB]
Get:48 http://172.17.0.1/private bookworm-staging/main armhf dwz armhf 0.14-1 [83.0 kB]
Get:49 http://172.17.0.1/private bookworm-staging/main armhf libicu67 armhf 67.1-7 [8291 kB]
Get:50 http://172.17.0.1/private bookworm-staging/main armhf libxml2 armhf 2.9.12+dfsg-5 [584 kB]
Get:51 http://172.17.0.1/private bookworm-staging/main armhf gettext armhf 0.21-4 [1215 kB]
Get:52 http://172.17.0.1/private bookworm-staging/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB]
Get:53 http://172.17.0.1/private bookworm-staging/main armhf po-debconf all 1.0.21+nmu1 [248 kB]
Get:54 http://172.17.0.1/private bookworm-staging/main armhf debhelper all 13.5.2 [1056 kB]
Get:55 http://172.17.0.1/private bookworm-staging/main armhf python3-lib2to3 all 3.9.7-1 [79.4 kB]
Get:56 http://172.17.0.1/private bookworm-staging/main armhf python3-distutils all 3.9.7-1 [146 kB]
Get:57 http://172.17.0.1/private bookworm-staging/main armhf dh-python all 4.20201102+nmu1 [99.4 kB]
Get:58 http://172.17.0.1/private bookworm-staging/main armhf fonts-lyx all 2.3.6-1 [205 kB]
Get:59 http://172.17.0.1/private bookworm-staging/main armhf libblas3 armhf 3.10.0-1 [108 kB]
Get:60 http://172.17.0.1/private bookworm-staging/main armhf libbrotli1 armhf 1.0.9-2+b1 [261 kB]
Get:61 http://172.17.0.1/private bookworm-staging/main armhf libmd0 armhf 1.0.4-1 [28.9 kB]
Get:62 http://172.17.0.1/private bookworm-staging/main armhf libbsd0 armhf 0.11.3-1 [103 kB]
Get:63 http://172.17.0.1/private bookworm-staging/main armhf libdeflate0 armhf 1.8-1 [44.1 kB]
Get:64 http://172.17.0.1/private bookworm-staging/main armhf libexpat1-dev armhf 2.4.1-2 [135 kB]
Get:65 http://172.17.0.1/private bookworm-staging/main armhf libpng16-16 armhf 1.6.37-3 [276 kB]
Get:66 http://172.17.0.1/private bookworm-staging/main armhf libfreetype6 armhf 2.10.4+dfsg-1 [353 kB]
Get:67 http://172.17.0.1/private bookworm-staging/main armhf libgfortran5 armhf 11.2.0-8+rpi1 [235 kB]
Get:68 http://172.17.0.1/private bookworm-staging/main armhf libimagequant0 armhf 2.12.2-1.1 [27.2 kB]
Get:69 http://172.17.0.1/private bookworm-staging/main armhf libjbig0 armhf 2.1-3.1+b2 [27.6 kB]
Get:70 http://172.17.0.1/private bookworm-staging/main armhf libjpeg62-turbo armhf 1:2.0.6-4 [122 kB]
Get:71 http://172.17.0.1/private bookworm-staging/main armhf libjs-jquery all 3.5.1+dfsg+~3.5.5-7 [315 kB]
Get:72 http://172.17.0.1/private bookworm-staging/main armhf libjs-jquery-ui all 1.12.1+dfsg-8 [232 kB]
Get:73 http://172.17.0.1/private bookworm-staging/main armhf libjs-underscore all 1.9.1~dfsg-4 [100 kB]
Get:74 http://172.17.0.1/private bookworm-staging/main armhf libjs-sphinxdoc all 4.2.0-4 [137 kB]
Get:75 http://172.17.0.1/private bookworm-staging/main armhf liblapack3 armhf 3.10.0-1 [1594 kB]
Get:76 http://172.17.0.1/private bookworm-staging/main armhf liblbfgsb0 armhf 3.0+dfsg.3-9 [24.6 kB]
Get:77 http://172.17.0.1/private bookworm-staging/main armhf liblcms2-2 armhf 2.12~rc1-2 [121 kB]
Get:78 http://172.17.0.1/private bookworm-staging/main armhf libpython3.9 armhf 3.9.7-4+rpi1 [1416 kB]
Get:79 http://172.17.0.1/private bookworm-staging/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-2 [184 kB]
Get:80 http://172.17.0.1/private bookworm-staging/main armhf libpython3.9-dev armhf 3.9.7-4+rpi1 [3060 kB]
Get:81 http://172.17.0.1/private bookworm-staging/main armhf libpython3-dev armhf 3.9.2-3 [21.7 kB]
Get:82 http://172.17.0.1/private bookworm-staging/main armhf libwebp6 armhf 0.6.1-2.1 [225 kB]
Get:83 http://172.17.0.1/private bookworm-staging/main armhf libtiff5 armhf 4.3.0-2 [272 kB]
Get:84 http://172.17.0.1/private bookworm-staging/main armhf libwebpdemux2 armhf 0.6.1-2.1 [86.8 kB]
Get:85 http://172.17.0.1/private bookworm-staging/main armhf libwebpmux3 armhf 0.6.1-2.1 [94.4 kB]
Get:86 http://172.17.0.1/private bookworm-staging/main armhf libxau6 armhf 1:1.0.9-1 [19.1 kB]
Get:87 http://172.17.0.1/private bookworm-staging/main armhf libxdmcp6 armhf 1:1.1.2-3 [25.0 kB]
Get:88 http://172.17.0.1/private bookworm-staging/main armhf libxcb1 armhf 1.14-3 [136 kB]
Get:89 http://172.17.0.1/private bookworm-staging/main armhf ttf-bitstream-vera all 1.10-8.1 [223 kB]
Get:90 http://172.17.0.1/private bookworm-staging/main armhf python-matplotlib-data all 3.3.4-2 [4154 kB]
Get:91 http://172.17.0.1/private bookworm-staging/main armhf python3-six all 1.16.0-2 [17.5 kB]
Get:92 http://172.17.0.1/private bookworm-staging/main armhf python3-cycler all 0.10.0-3 [8084 B]
Get:93 http://172.17.0.1/private bookworm-staging/main armhf python3-dateutil all 2.8.1-6 [79.2 kB]
Get:94 http://172.17.0.1/private bookworm-staging/main armhf python3-decorator all 4.4.2-2 [15.8 kB]
Get:95 http://172.17.0.1/private bookworm-staging/main armhf python3.9-dev armhf 3.9.7-4+rpi1 [501 kB]
Get:96 http://172.17.0.1/private bookworm-staging/main armhf python3-dev armhf 3.9.2-3 [24.8 kB]
Get:97 http://172.17.0.1/private bookworm-staging/main armhf python3-kiwisolver armhf 1.3.1-2 [45.7 kB]
Get:98 http://172.17.0.1/private bookworm-staging/main armhf python3-pyparsing all 2.4.7-1 [109 kB]
Get:99 http://172.17.0.1/private bookworm-staging/main armhf python3-pkg-resources all 52.0.0-4 [190 kB]
Get:100 http://172.17.0.1/private bookworm-staging/main armhf python3-numpy armhf 1:1.19.5-1 [2930 kB]
Get:101 http://172.17.0.1/private bookworm-staging/main armhf python3-pil armhf 8.1.2+dfsg-0.3 [410 kB]
Get:102 http://172.17.0.1/private bookworm-staging/main armhf python3-matplotlib armhf 3.3.4-2 [6035 kB]
Get:103 http://172.17.0.1/private bookworm-staging/main armhf python3-tz all 2021.3-1 [34.9 kB]
Get:104 http://172.17.0.1/private bookworm-staging/main armhf python3-pandas-lib armhf 1.1.5+dfsg-2 [2863 kB]
Get:105 http://172.17.0.1/private bookworm-staging/main armhf python3-pandas all 1.1.5+dfsg-2 [2096 kB]
Get:106 http://172.17.0.1/private bookworm-staging/main armhf python3-patsy all 0.5.2-2 [173 kB]
Get:107 http://172.17.0.1/private bookworm-staging/main armhf python3-pubsub all 4.0.3-4 [46.6 kB]
Get:108 http://172.17.0.1/private bookworm-staging/main armhf python3-scipy armhf 1.6.0-2 [11.1 MB]
Get:109 http://172.17.0.1/private bookworm-staging/main armhf python3-setuptools all 52.0.0-4 [366 kB]
Get:110 http://172.17.0.1/private bookworm-staging/main armhf python3-statsmodels-lib armhf 0.12.2-2+rpi1 [1138 kB]
Get:111 http://172.17.0.1/private bookworm-staging/main armhf python3-statsmodels all 0.12.2-2+rpi1 [4453 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 73.5 MB in 21s (3452 kB/s)
Selecting previously unselected package bsdextrautils.
(Reading database ... 12484 files and directories currently installed.)
Preparing to unpack .../bsdextrautils_2.37.2-3_armhf.deb ...
Unpacking bsdextrautils (2.37.2-3) ...
Preparing to unpack .../libasan6_11.2.0-8+rpi1_armhf.deb ...
Unpacking libasan6:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Preparing to unpack .../libubsan1_11.2.0-8+rpi1_armhf.deb ...
Unpacking libubsan1:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Preparing to unpack .../libgomp1_11.2.0-8+rpi1_armhf.deb ...
Unpacking libgomp1:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Preparing to unpack .../gcc-11-base_11.2.0-8+rpi1_armhf.deb ...
Unpacking gcc-11-base:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Setting up gcc-11-base:armhf (11.2.0-8+rpi1) ...
(Reading database ... 12515 files and directories currently installed.)
Preparing to unpack .../libgcc-s1_11.2.0-8+rpi1_armhf.deb ...
Unpacking libgcc-s1:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Setting up libgcc-s1:armhf (11.2.0-8+rpi1) ...
(Reading database ... 12515 files and directories currently installed.)
Preparing to unpack .../libcc1-0_11.2.0-8+rpi1_armhf.deb ...
Unpacking libcc1-0:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Preparing to unpack .../libatomic1_11.2.0-8+rpi1_armhf.deb ...
Unpacking libatomic1:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Preparing to unpack .../libstdc++6_11.2.0-8+rpi1_armhf.deb ...
Unpacking libstdc++6:armhf (11.2.0-8+rpi1) over (11.2.0-4+rpi1) ...
Setting up libstdc++6:armhf (11.2.0-8+rpi1) ...
Selecting previously unselected package libuchardet0:armhf.
(Reading database ... 12515 files and directories currently installed.)
Preparing to unpack .../0-libuchardet0_0.0.7-1_armhf.deb ...
Unpacking libuchardet0:armhf (0.0.7-1) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../1-groff-base_1.22.4-7_armhf.deb ...
Unpacking groff-base (1.22.4-7) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../2-libpipeline1_1.5.3-1_armhf.deb ...
Unpacking libpipeline1:armhf (1.5.3-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../3-man-db_2.9.4-2_armhf.deb ...
Unpacking man-db (2.9.4-2) ...
Selecting previously unselected package libpython3.9-minimal:armhf.
Preparing to unpack .../4-libpython3.9-minimal_3.9.7-4+rpi1_armhf.deb ...
Unpacking libpython3.9-minimal:armhf (3.9.7-4+rpi1) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../5-libexpat1_2.4.1-2_armhf.deb ...
Unpacking libexpat1:armhf (2.4.1-2) ...
Selecting previously unselected package python3.9-minimal.
Preparing to unpack .../6-python3.9-minimal_3.9.7-4+rpi1_armhf.deb ...
Unpacking python3.9-minimal (3.9.7-4+rpi1) ...
Setting up libpython3.9-minimal:armhf (3.9.7-4+rpi1) ...
Setting up libexpat1:armhf (2.4.1-2) ...
Setting up python3.9-minimal (3.9.7-4+rpi1) ...
Selecting previously unselected package python3-minimal.
(Reading database ... 13351 files and directories currently installed.)
Preparing to unpack .../0-python3-minimal_3.9.2-3_armhf.deb ...
Unpacking python3-minimal (3.9.2-3) ...
Selecting previously unselected package media-types.
Preparing to unpack .../1-media-types_4.0.0_all.deb ...
Unpacking media-types (4.0.0) ...
Selecting previously unselected package mailcap.
Preparing to unpack .../2-mailcap_3.70_all.deb ...
Unpacking mailcap (3.70) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../3-mime-support_3.66_all.deb ...
Unpacking mime-support (3.66) ...
Selecting previously unselected package libffi8:armhf.
Preparing to unpack .../4-libffi8_3.4.2-2_armhf.deb ...
Unpacking libffi8:armhf (3.4.2-2) ...
Selecting previously unselected package libmpdec3:armhf.
Preparing to unpack .../5-libmpdec3_2.5.1-2+rpi1_armhf.deb ...
Unpacking libmpdec3:armhf (2.5.1-2+rpi1) ...
Selecting previously unselected package libpython3.9-stdlib:armhf.
Preparing to unpack .../6-libpython3.9-stdlib_3.9.7-4+rpi1_armhf.deb ...
Unpacking libpython3.9-stdlib:armhf (3.9.7-4+rpi1) ...
Selecting previously unselected package python3.9.
Preparing to unpack .../7-python3.9_3.9.7-4+rpi1_armhf.deb ...
Unpacking python3.9 (3.9.7-4+rpi1) ...
Selecting previously unselected package libpython3-stdlib:armhf.
Preparing to unpack .../8-libpython3-stdlib_3.9.2-3_armhf.deb ...
Unpacking libpython3-stdlib:armhf (3.9.2-3) ...
Setting up python3-minimal (3.9.2-3) ...
Selecting previously unselected package python3.
(Reading database ... 13778 files and directories currently installed.)
Preparing to unpack .../00-python3_3.9.2-3_armhf.deb ...
Unpacking python3 (3.9.2-3) ...
Selecting previously unselected package sensible-utils.
Preparing to unpack .../01-sensible-utils_0.0.17_all.deb ...
Unpacking sensible-utils (0.0.17) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_armhf.deb ...
Unpacking libmagic-mgc (1:5.39-3) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../03-libmagic1_1%3a5.39-3_armhf.deb ...
Unpacking libmagic1:armhf (1:5.39-3) ...
Selecting previously unselected package file.
Preparing to unpack .../04-file_1%3a5.39-3_armhf.deb ...
Unpacking file (1:5.39-3) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../05-gettext-base_0.21-4_armhf.deb ...
Unpacking gettext-base (0.21-4) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../06-libsigsegv2_2.13-1_armhf.deb ...
Unpacking libsigsegv2:armhf (2.13-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../07-m4_1.4.18-5_armhf.deb ...
Unpacking m4 (1.4.18-5) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../08-autoconf_2.71-2_all.deb ...
Unpacking autoconf (2.71-2) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ...
Unpacking autotools-dev (20180224.1+nmu1) ...
Selecting previously unselected package automake.
Preparing to unpack .../10-automake_1%3a1.16.4-2_all.deb ...
Unpacking automake (1:1.16.4-2) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../11-autopoint_0.21-4_all.deb ...
Unpacking autopoint (0.21-4) ...
Selecting previously unselected package bwa.
Preparing to unpack .../12-bwa_0.7.17-6_armhf.deb ...
Unpacking bwa (0.7.17-6) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../13-libdebhelper-perl_13.5.2_all.deb ...
Unpacking libdebhelper-perl (13.5.2) ...
Selecting previously unselected package libtool.
Preparing to unpack .../14-libtool_2.4.6-15_all.deb ...
Unpacking libtool (2.4.6-15) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../15-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../16-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libsub-override-perl.
Preparing to unpack .../17-libsub-override-perl_0.09-2_all.deb ...
Unpacking libsub-override-perl (0.09-2) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../18-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../19-dh-strip-nondeterminism_1.12.0-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.12.0-1) ...
Selecting previously unselected package libelf1:armhf.
Preparing to unpack .../20-libelf1_0.185-2_armhf.deb ...
Unpacking libelf1:armhf (0.185-2) ...
Selecting previously unselected package dwz.
Preparing to unpack .../21-dwz_0.14-1_armhf.deb ...
Unpacking dwz (0.14-1) ...
Selecting previously unselected package libicu67:armhf.
Preparing to unpack .../22-libicu67_67.1-7_armhf.deb ...
Unpacking libicu67:armhf (67.1-7) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../23-libxml2_2.9.12+dfsg-5_armhf.deb ...
Unpacking libxml2:armhf (2.9.12+dfsg-5) ...
Selecting previously unselected package gettext.
Preparing to unpack .../24-gettext_0.21-4_armhf.deb ...
Unpacking gettext (0.21-4) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../25-intltool-debian_0.35.0+20060710.5_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.5) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../26-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../27-debhelper_13.5.2_all.deb ...
Unpacking debhelper (13.5.2) ...
Selecting previously unselected package python3-lib2to3.
Preparing to unpack .../28-python3-lib2to3_3.9.7-1_all.deb ...
Unpacking python3-lib2to3 (3.9.7-1) ...
Selecting previously unselected package python3-distutils.
Preparing to unpack .../29-python3-distutils_3.9.7-1_all.deb ...
Unpacking python3-distutils (3.9.7-1) ...
Selecting previously unselected package dh-python.
Preparing to unpack .../30-dh-python_4.20201102+nmu1_all.deb ...
Unpacking dh-python (4.20201102+nmu1) ...
Selecting previously unselected package fonts-lyx.
Preparing to unpack .../31-fonts-lyx_2.3.6-1_all.deb ...
Unpacking fonts-lyx (2.3.6-1) ...
Selecting previously unselected package libblas3:armhf.
Preparing to unpack .../32-libblas3_3.10.0-1_armhf.deb ...
Unpacking libblas3:armhf (3.10.0-1) ...
Selecting previously unselected package libbrotli1:armhf.
Preparing to unpack .../33-libbrotli1_1.0.9-2+b1_armhf.deb ...
Unpacking libbrotli1:armhf (1.0.9-2+b1) ...
Selecting previously unselected package libmd0:armhf.
Preparing to unpack .../34-libmd0_1.0.4-1_armhf.deb ...
Unpacking libmd0:armhf (1.0.4-1) ...
Selecting previously unselected package libbsd0:armhf.
Preparing to unpack .../35-libbsd0_0.11.3-1_armhf.deb ...
Unpacking libbsd0:armhf (0.11.3-1) ...
Selecting previously unselected package libdeflate0:armhf.
Preparing to unpack .../36-libdeflate0_1.8-1_armhf.deb ...
Unpacking libdeflate0:armhf (1.8-1) ...
Selecting previously unselected package libexpat1-dev:armhf.
Preparing to unpack .../37-libexpat1-dev_2.4.1-2_armhf.deb ...
Unpacking libexpat1-dev:armhf (2.4.1-2) ...
Selecting previously unselected package libpng16-16:armhf.
Preparing to unpack .../38-libpng16-16_1.6.37-3_armhf.deb ...
Unpacking libpng16-16:armhf (1.6.37-3) ...
Selecting previously unselected package libfreetype6:armhf.
Preparing to unpack .../39-libfreetype6_2.10.4+dfsg-1_armhf.deb ...
Unpacking libfreetype6:armhf (2.10.4+dfsg-1) ...
Selecting previously unselected package libgfortran5:armhf.
Preparing to unpack .../40-libgfortran5_11.2.0-8+rpi1_armhf.deb ...
Unpacking libgfortran5:armhf (11.2.0-8+rpi1) ...
Selecting previously unselected package libimagequant0:armhf.
Preparing to unpack .../41-libimagequant0_2.12.2-1.1_armhf.deb ...
Unpacking libimagequant0:armhf (2.12.2-1.1) ...
Selecting previously unselected package libjbig0:armhf.
Preparing to unpack .../42-libjbig0_2.1-3.1+b2_armhf.deb ...
Unpacking libjbig0:armhf (2.1-3.1+b2) ...
Selecting previously unselected package libjpeg62-turbo:armhf.
Preparing to unpack .../43-libjpeg62-turbo_1%3a2.0.6-4_armhf.deb ...
Unpacking libjpeg62-turbo:armhf (1:2.0.6-4) ...
Selecting previously unselected package libjs-jquery.
Preparing to unpack .../44-libjs-jquery_3.5.1+dfsg+~3.5.5-7_all.deb ...
Unpacking libjs-jquery (3.5.1+dfsg+~3.5.5-7) ...
Selecting previously unselected package libjs-jquery-ui.
Preparing to unpack .../45-libjs-jquery-ui_1.12.1+dfsg-8_all.deb ...
Unpacking libjs-jquery-ui (1.12.1+dfsg-8) ...
Selecting previously unselected package libjs-underscore.
Preparing to unpack .../46-libjs-underscore_1.9.1~dfsg-4_all.deb ...
Unpacking libjs-underscore (1.9.1~dfsg-4) ...
Selecting previously unselected package libjs-sphinxdoc.
Preparing to unpack .../47-libjs-sphinxdoc_4.2.0-4_all.deb ...
Unpacking libjs-sphinxdoc (4.2.0-4) ...
Selecting previously unselected package liblapack3:armhf.
Preparing to unpack .../48-liblapack3_3.10.0-1_armhf.deb ...
Unpacking liblapack3:armhf (3.10.0-1) ...
Selecting previously unselected package liblbfgsb0:armhf.
Preparing to unpack .../49-liblbfgsb0_3.0+dfsg.3-9_armhf.deb ...
Unpacking liblbfgsb0:armhf (3.0+dfsg.3-9) ...
Selecting previously unselected package liblcms2-2:armhf.
Preparing to unpack .../50-liblcms2-2_2.12~rc1-2_armhf.deb ...
Unpacking liblcms2-2:armhf (2.12~rc1-2) ...
Selecting previously unselected package libpython3.9:armhf.
Preparing to unpack .../51-libpython3.9_3.9.7-4+rpi1_armhf.deb ...
Unpacking libpython3.9:armhf (3.9.7-4+rpi1) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../52-zlib1g-dev_1%3a1.2.11.dfsg-2_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-2) ...
Selecting previously unselected package libpython3.9-dev:armhf.
Preparing to unpack .../53-libpython3.9-dev_3.9.7-4+rpi1_armhf.deb ...
Unpacking libpython3.9-dev:armhf (3.9.7-4+rpi1) ...
Selecting previously unselected package libpython3-dev:armhf.
Preparing to unpack .../54-libpython3-dev_3.9.2-3_armhf.deb ...
Unpacking libpython3-dev:armhf (3.9.2-3) ...
Selecting previously unselected package libwebp6:armhf.
Preparing to unpack .../55-libwebp6_0.6.1-2.1_armhf.deb ...
Unpacking libwebp6:armhf (0.6.1-2.1) ...
Selecting previously unselected package libtiff5:armhf.
Preparing to unpack .../56-libtiff5_4.3.0-2_armhf.deb ...
Unpacking libtiff5:armhf (4.3.0-2) ...
Selecting previously unselected package libwebpdemux2:armhf.
Preparing to unpack .../57-libwebpdemux2_0.6.1-2.1_armhf.deb ...
Unpacking libwebpdemux2:armhf (0.6.1-2.1) ...
Selecting previously unselected package libwebpmux3:armhf.
Preparing to unpack .../58-libwebpmux3_0.6.1-2.1_armhf.deb ...
Unpacking libwebpmux3:armhf (0.6.1-2.1) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../59-libxau6_1%3a1.0.9-1_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.9-1) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../60-libxdmcp6_1%3a1.1.2-3_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-3) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../61-libxcb1_1.14-3_armhf.deb ...
Unpacking libxcb1:armhf (1.14-3) ...
Selecting previously unselected package ttf-bitstream-vera.
Preparing to unpack .../62-ttf-bitstream-vera_1.10-8.1_all.deb ...
Unpacking ttf-bitstream-vera (1.10-8.1) ...
Selecting previously unselected package python-matplotlib-data.
Preparing to unpack .../63-python-matplotlib-data_3.3.4-2_all.deb ...
Unpacking python-matplotlib-data (3.3.4-2) ...
Selecting previously unselected package python3-six.
Preparing to unpack .../64-python3-six_1.16.0-2_all.deb ...
Unpacking python3-six (1.16.0-2) ...
Selecting previously unselected package python3-cycler.
Preparing to unpack .../65-python3-cycler_0.10.0-3_all.deb ...
Unpacking python3-cycler (0.10.0-3) ...
Selecting previously unselected package python3-dateutil.
Preparing to unpack .../66-python3-dateutil_2.8.1-6_all.deb ...
Unpacking python3-dateutil (2.8.1-6) ...
Selecting previously unselected package python3-decorator.
Preparing to unpack .../67-python3-decorator_4.4.2-2_all.deb ...
Unpacking python3-decorator (4.4.2-2) ...
Selecting previously unselected package python3.9-dev.
Preparing to unpack .../68-python3.9-dev_3.9.7-4+rpi1_armhf.deb ...
Unpacking python3.9-dev (3.9.7-4+rpi1) ...
Selecting previously unselected package python3-dev.
Preparing to unpack .../69-python3-dev_3.9.2-3_armhf.deb ...
Unpacking python3-dev (3.9.2-3) ...
Selecting previously unselected package python3-kiwisolver.
Preparing to unpack .../70-python3-kiwisolver_1.3.1-2_armhf.deb ...
Unpacking python3-kiwisolver (1.3.1-2) ...
Selecting previously unselected package python3-pyparsing.
Preparing to unpack .../71-python3-pyparsing_2.4.7-1_all.deb ...
Unpacking python3-pyparsing (2.4.7-1) ...
Selecting previously unselected package python3-pkg-resources.
Preparing to unpack .../72-python3-pkg-resources_52.0.0-4_all.deb ...
Unpacking python3-pkg-resources (52.0.0-4) ...
Selecting previously unselected package python3-numpy.
Preparing to unpack .../73-python3-numpy_1%3a1.19.5-1_armhf.deb ...
Unpacking python3-numpy (1:1.19.5-1) ...
Selecting previously unselected package python3-pil:armhf.
Preparing to unpack .../74-python3-pil_8.1.2+dfsg-0.3_armhf.deb ...
Unpacking python3-pil:armhf (8.1.2+dfsg-0.3) ...
Selecting previously unselected package python3-matplotlib.
Preparing to unpack .../75-python3-matplotlib_3.3.4-2_armhf.deb ...
Unpacking python3-matplotlib (3.3.4-2) ...
Selecting previously unselected package python3-tz.
Preparing to unpack .../76-python3-tz_2021.3-1_all.deb ...
Unpacking python3-tz (2021.3-1) ...
Selecting previously unselected package python3-pandas-lib:armhf.
Preparing to unpack .../77-python3-pandas-lib_1.1.5+dfsg-2_armhf.deb ...
Unpacking python3-pandas-lib:armhf (1.1.5+dfsg-2) ...
Selecting previously unselected package python3-pandas.
Preparing to unpack .../78-python3-pandas_1.1.5+dfsg-2_all.deb ...
Unpacking python3-pandas (1.1.5+dfsg-2) ...
Selecting previously unselected package python3-patsy.
Preparing to unpack .../79-python3-patsy_0.5.2-2_all.deb ...
Unpacking python3-patsy (0.5.2-2) ...
Selecting previously unselected package python3-pubsub.
Preparing to unpack .../80-python3-pubsub_4.0.3-4_all.deb ...
Unpacking python3-pubsub (4.0.3-4) ...
Selecting previously unselected package python3-scipy.
Preparing to unpack .../81-python3-scipy_1.6.0-2_armhf.deb ...
Unpacking python3-scipy (1.6.0-2) ...
Selecting previously unselected package python3-setuptools.
Preparing to unpack .../82-python3-setuptools_52.0.0-4_all.deb ...
Unpacking python3-setuptools (52.0.0-4) ...
Selecting previously unselected package python3-statsmodels-lib:armhf.
Preparing to unpack .../83-python3-statsmodels-lib_0.12.2-2+rpi1_armhf.deb ...
Unpacking python3-statsmodels-lib:armhf (0.12.2-2+rpi1) ...
Selecting previously unselected package python3-statsmodels.
Preparing to unpack .../84-python3-statsmodels_0.12.2-2+rpi1_all.deb ...
Unpacking python3-statsmodels (0.12.2-2+rpi1) ...
Selecting previously unselected package sbuild-build-depends-tnseq-transit-dummy.
Preparing to unpack .../85-sbuild-build-depends-tnseq-transit-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-tnseq-transit-dummy (0.invalid.0) ...
Setting up media-types (4.0.0) ...
Setting up libpipeline1:armhf (1.5.3-1) ...
Setting up liblcms2-2:armhf (2.12~rc1-2) ...
Setting up libxau6:armhf (1:1.0.9-1) ...
Setting up ttf-bitstream-vera (1.10-8.1) ...
Setting up bsdextrautils (2.37.2-3) ...
update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode
Setting up libicu67:armhf (67.1-7) ...
Setting up libmagic-mgc (1:5.39-3) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up bwa (0.7.17-6) ...
Setting up fonts-lyx (2.3.6-1) ...
Setting up libdebhelper-perl (13.5.2) ...
Setting up libbrotli1:armhf (1.0.9-2+b1) ...
Setting up libmagic1:armhf (1:5.39-3) ...
Setting up libdeflate0:armhf (1.8-1) ...
Setting up gettext-base (0.21-4) ...
Setting up file (1:5.39-3) ...
Setting up libgomp1:armhf (11.2.0-8+rpi1) ...
Setting up libjbig0:armhf (2.1-3.1+b2) ...
Setting up libasan6:armhf (11.2.0-8+rpi1) ...
Setting up autotools-dev (20180224.1+nmu1) ...
Setting up libblas3:armhf (3.10.0-1) ...
update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode
Setting up libexpat1-dev:armhf (2.4.1-2) ...
Setting up libjpeg62-turbo:armhf (1:2.0.6-4) ...
Setting up libsigsegv2:armhf (2.13-1) ...
Setting up libimagequant0:armhf (2.12.2-1.1) ...
Setting up libpng16-16:armhf (1.6.37-3) ...
Setting up libatomic1:armhf (11.2.0-8+rpi1) ...
Setting up autopoint (0.21-4) ...
Setting up libwebp6:armhf (0.6.1-2.1) ...
Setting up libgfortran5:armhf (11.2.0-8+rpi1) ...
Setting up libubsan1:armhf (11.2.0-8+rpi1) ...
Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-2) ...
Setting up libffi8:armhf (3.4.2-2) ...
Setting up libmd0:armhf (1.0.4-1) ...
Setting up sensible-utils (0.0.17) ...
Setting up libuchardet0:armhf (0.0.7-1) ...
Setting up libmpdec3:armhf (2.5.1-2+rpi1) ...
Setting up libsub-override-perl (0.09-2) ...
Setting up libtiff5:armhf (4.3.0-2) ...
Setting up libjs-jquery (3.5.1+dfsg+~3.5.5-7) ...
Setting up python-matplotlib-data (3.3.4-2) ...
Setting up libwebpmux3:armhf (0.6.1-2.1) ...
Setting up libbsd0:armhf (0.11.3-1) ...
Setting up mailcap (3.70) ...
Setting up libelf1:armhf (0.185-2) ...
Setting up libxml2:armhf (2.9.12+dfsg-5) ...
Setting up libcc1-0:armhf (11.2.0-8+rpi1) ...
Setting up libpython3.9-stdlib:armhf (3.9.7-4+rpi1) ...
Setting up libpython3-stdlib:armhf (3.9.2-3) ...
Setting up libjs-underscore (1.9.1~dfsg-4) ...
Setting up libfile-stripnondeterminism-perl (1.12.0-1) ...
Setting up libxdmcp6:armhf (1:1.1.2-3) ...
Setting up liblapack3:armhf (3.10.0-1) ...
update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode
Setting up libxcb1:armhf (1.14-3) ...
Setting up gettext (0.21-4) ...
Setting up mime-support (3.66) ...
Setting up libtool (2.4.6-15) ...
Setting up libwebpdemux2:armhf (0.6.1-2.1) ...
Setting up m4 (1.4.18-5) ...
Setting up intltool-debian (0.35.0+20060710.5) ...
Setting up libpython3.9:armhf (3.9.7-4+rpi1) ...
Setting up libjs-jquery-ui (1.12.1+dfsg-8) ...
Setting up libfreetype6:armhf (2.10.4+dfsg-1) ...
Setting up libjs-sphinxdoc (4.2.0-4) ...
Setting up autoconf (2.71-2) ...
Setting up dh-strip-nondeterminism (1.12.0-1) ...
Setting up dwz (0.14-1) ...
Setting up groff-base (1.22.4-7) ...
Setting up python3.9 (3.9.7-4+rpi1) ...
Setting up liblbfgsb0:armhf (3.0+dfsg.3-9) ...
Setting up automake (1:1.16.4-2) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libpython3.9-dev:armhf (3.9.7-4+rpi1) ...
Setting up python3 (3.9.2-3) ...
Setting up man-db (2.9.4-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up python3-tz (2021.3-1) ...
Setting up python3-six (1.16.0-2) ...
Setting up dh-autoreconf (20) ...
Setting up python3-pil:armhf (8.1.2+dfsg-0.3) ...
Setting up python3-decorator (4.4.2-2) ...
Setting up python3-pyparsing (2.4.7-1) ...
Setting up python3-cycler (0.10.0-3) ...
Setting up python3-kiwisolver (1.3.1-2) ...
Setting up python3-pubsub (4.0.3-4) ...
Setting up python3.9-dev (3.9.7-4+rpi1) ...
Setting up python3-dateutil (2.8.1-6) ...
Setting up python3-lib2to3 (3.9.7-1) ...
Setting up python3-pkg-resources (52.0.0-4) ...
Setting up python3-distutils (3.9.7-1) ...
Setting up dh-python (4.20201102+nmu1) ...
Setting up libpython3-dev:armhf (3.9.2-3) ...
Setting up python3-setuptools (52.0.0-4) ...
Setting up debhelper (13.5.2) ...
Setting up python3-dev (3.9.2-3) ...
Setting up python3-numpy (1:1.19.5-1) ...
Setting up python3-statsmodels-lib:armhf (0.12.2-2+rpi1) ...
Setting up python3-matplotlib (3.3.4-2) ...
Setting up python3-scipy (1.6.0-2) ...
Setting up python3-pandas-lib:armhf (1.1.5+dfsg-2) ...
Setting up python3-patsy (0.5.2-2) ...
Setting up python3-pandas (1.1.5+dfsg-2) ...
Setting up python3-statsmodels (0.12.2-2+rpi1) ...
Setting up sbuild-build-depends-tnseq-transit-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.32-4+rpi1) ...
W: No sandbox user '_apt' on the system, can not drop privileges
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 4.9.0-0.bpo.6-armmp armhf (armv7l)
Toolchain package versions: binutils_2.37-5+rpi1 dpkg-dev_1.20.9+rpi1 g++-10_10.3.0-9+rpi1 gcc-10_10.3.0-9+rpi1 libc6-dev_2.32-4+rpi1 libstdc++-10-dev_10.3.0-9+rpi1 libstdc++6_11.2.0-8+rpi1 linux-libc-dev_5.10.46-4+rpi1
Package versions: adduser_3.118 apt_2.3.9 autoconf_2.71-2 automake_1:1.16.4-2 autopoint_0.21-4 autotools-dev_20180224.1+nmu1 base-files_12+rpi1 base-passwd_3.5.51 bash_5.1-3 binutils_2.37-5+rpi1 binutils-arm-linux-gnueabihf_2.37-5+rpi1 binutils-common_2.37-5+rpi1 bsdextrautils_2.37.2-3 bsdutils_1:2.37.2-1 build-essential_12.9 bwa_0.7.17-6 bzip2_1.0.8-4 coreutils_8.32-4 cpp_4:10.2.1-1+rpi1 cpp-10_10.3.0-9+rpi1 dash_0.5.11+git20210120+802ebd4-1 debconf_1.5.77 debhelper_13.5.2 debianutils_4.11.2 dh-autoreconf_20 dh-python_4.20201102+nmu1 dh-strip-nondeterminism_1.12.0-1 diffutils_1:3.7-5 dirmngr_2.2.27-2 dpkg_1.20.9+rpi1 dpkg-dev_1.20.9+rpi1 dwz_0.14-1 e2fsprogs_1.46.4-1 fakeroot_1.25.3-1.1 file_1:5.39-3 findutils_4.8.0-1 fonts-lyx_2.3.6-1 g++_4:10.2.1-1+rpi1 g++-10_10.3.0-9+rpi1 gcc_4:10.2.1-1+rpi1 gcc-10_10.3.0-9+rpi1 gcc-10-base_10.3.0-9+rpi1 gcc-11-base_11.2.0-8+rpi1 gcc-7-base_7.5.0-6+rpi1+b2 gcc-8-base_8.4.0-7+rpi1 gcc-9-base_9.4.0-2+rpi1 gettext_0.21-4 gettext-base_0.21-4 gnupg_2.2.27-2 gnupg-l10n_2.2.27-2 gnupg-utils_2.2.27-2 gpg_2.2.27-2 gpg-agent_2.2.27-2 gpg-wks-client_2.2.27-2 gpg-wks-server_2.2.27-2 gpgconf_2.2.27-2 gpgsm_2.2.27-2 gpgv_2.2.27-2 grep_3.7-1 groff-base_1.22.4-7 gzip_1.10-4 hostname_3.23 init-system-helpers_1.60 intltool-debian_0.35.0+20060710.5 libacl1_2.3.1-1 libapt-pkg6.0_2.3.9 libarchive-zip-perl_1.68-1 libasan6_11.2.0-8+rpi1 libassuan0_2.5.5-1 libatomic1_11.2.0-8+rpi1 libattr1_1:2.5.1-1 libaudit-common_1:3.0.5-1 libaudit1_1:3.0.5-1 libbinutils_2.37-5+rpi1 libblas3_3.10.0-1 libblkid1_2.37.2-1 libbrotli1_1.0.9-2+b1 libbsd0_0.11.3-1 libbz2-1.0_1.0.8-4 libc-bin_2.32-4+rpi1 libc-dev-bin_2.32-4+rpi1 libc6_2.32-4+rpi1 libc6-dev_2.32-4+rpi1 libcap-ng0_0.7.9-2.2+b1 libcc1-0_11.2.0-8+rpi1 libcom-err2_1.46.4-1 libcrypt-dev_1:4.4.25-2 libcrypt1_1:4.4.25-2 libctf-nobfd0_2.37-5+rpi1 libctf0_2.37-5+rpi1 libdb5.3_5.3.28+dfsg1-0.8 libdebconfclient0_0.260 libdebhelper-perl_13.5.2 libdeflate0_1.8-1 libdpkg-perl_1.20.9+rpi1 libelf1_0.185-2 libexpat1_2.4.1-2 libexpat1-dev_2.4.1-2 libext2fs2_1.46.4-1 libfakeroot_1.25.3-1.1 libffi7_3.3-6 libffi8_3.4.2-2 libfile-stripnondeterminism-perl_1.12.0-1 libfreetype6_2.10.4+dfsg-1 libgcc-10-dev_10.3.0-9+rpi1 libgcc-s1_11.2.0-8+rpi1 libgcrypt20_1.9.4-3 libgdbm-compat4_1.21-1 libgdbm6_1.21-1 libgfortran5_11.2.0-8+rpi1 libgmp10_2:6.2.1+dfsg-2 libgnutls30_3.7.2-2 libgomp1_11.2.0-8+rpi1 libgpg-error0_1.42-3 libgssapi-krb5-2_1.18.3-7 libhogweed6_3.7.3-1 libicu67_67.1-7 libidn2-0_2.3.2-2 libimagequant0_2.12.2-1.1 libisl23_0.23-1 libjbig0_2.1-3.1+b2 libjpeg62-turbo_1:2.0.6-4 libjs-jquery_3.5.1+dfsg+~3.5.5-7 libjs-jquery-ui_1.12.1+dfsg-8 libjs-sphinxdoc_4.2.0-4 libjs-underscore_1.9.1~dfsg-4 libk5crypto3_1.18.3-7 libkeyutils1_1.6.1-2 libkrb5-3_1.18.3-7 libkrb5support0_1.18.3-7 libksba8_1.6.0-2 liblapack3_3.10.0-1 liblbfgsb0_3.0+dfsg.3-9 liblcms2-2_2.12~rc1-2 libldap-2.4-2_2.4.59+dfsg-1 liblocale-gettext-perl_1.07-4+b1 liblz4-1_1.9.3-2 liblzma5_5.2.5-2 libmagic-mgc_1:5.39-3 libmagic1_1:5.39-3 libmd0_1.0.4-1 libmount1_2.37.2-1 libmpc3_1.2.0-1 libmpdec3_2.5.1-2+rpi1 libmpfr6_4.1.0-3 libncursesw6_6.2+20201114-4 libnettle8_3.7.3-1 libnpth0_1.6-3 libnsl-dev_1.3.0-2 libnsl2_1.3.0-2 libp11-kit0_0.24.0-2 libpam-modules_1.4.0-10 libpam-modules-bin_1.4.0-10 libpam-runtime_1.4.0-10 libpam0g_1.4.0-10 libpcre2-8-0_10.36-2 libpcre3_2:8.39-13 libperl5.32_5.32.1-5 libpipeline1_1.5.3-1 libpng16-16_1.6.37-3 libpython3-dev_3.9.2-3 libpython3-stdlib_3.9.2-3 libpython3.9_3.9.7-4+rpi1 libpython3.9-dev_3.9.7-4+rpi1 libpython3.9-minimal_3.9.7-4+rpi1 libpython3.9-stdlib_3.9.7-4+rpi1 libreadline8_8.1-2 libsasl2-2_2.1.27+dfsg-2.1 libsasl2-modules-db_2.1.27+dfsg-2.1 libseccomp2_2.5.1-1+rpi1 libselinux1_3.1-3 libsemanage-common_3.1-1 libsemanage1_3.1-1+b1 libsepol1_3.1-1 libsigsegv2_2.13-1 libsmartcols1_2.37.2-1 libsqlite3-0_3.36.0-2 libss2_1.46.4-1 libssl1.1_1.1.1l-1 libstdc++-10-dev_10.3.0-9+rpi1 libstdc++6_11.2.0-8+rpi1 libsub-override-perl_0.09-2 libsystemd0_247.9-1+rpi1 libtasn1-6_4.17.0-2 libtext-charwidth-perl_0.04-10+b1 libtext-iconv-perl_1.7-7+b1 libtiff5_4.3.0-2 libtinfo6_6.2+20201114-4 libtirpc-common_1.3.2-2 libtirpc-dev_1.3.2-2 libtirpc3_1.3.2-2 libtool_2.4.6-15 libubsan1_11.2.0-8+rpi1 libuchardet0_0.0.7-1 libudev1_247.9-1+rpi1 libunistring2_0.9.10-6 libuuid1_2.37.2-1 libwebp6_0.6.1-2.1 libwebpdemux2_0.6.1-2.1 libwebpmux3_0.6.1-2.1 libxau6_1:1.0.9-1 libxcb1_1.14-3 libxdmcp6_1:1.1.2-3 libxml2_2.9.12+dfsg-5 libxxhash0_0.8.0-2+rpi1 libzstd1_1.4.8+dfsg-2.1+rpi1 linux-libc-dev_5.10.46-4+rpi1 login_1:4.8.1-1 logsave_1.46.4-1 lsb-base_11.1.0+rpi1 m4_1.4.18-5 mailcap_3.70 make_4.3-4.1 man-db_2.9.4-2 mawk_1.3.4.20200120-2 media-types_4.0.0 mime-support_3.66 mount_2.37.2-1 ncurses-base_6.2+20201114-4 ncurses-bin_6.2+20201114-4 netbase_6.3 passwd_1:4.8.1-1 patch_2.7.6-7 perl_5.32.1-5 perl-base_5.32.1-5 perl-modules-5.32_5.32.1-5 pinentry-curses_1.1.0-4 po-debconf_1.0.21+nmu1 python-matplotlib-data_3.3.4-2 python3_3.9.2-3 python3-cycler_0.10.0-3 python3-dateutil_2.8.1-6 python3-decorator_4.4.2-2 python3-dev_3.9.2-3 python3-distutils_3.9.7-1 python3-kiwisolver_1.3.1-2 python3-lib2to3_3.9.7-1 python3-matplotlib_3.3.4-2 python3-minimal_3.9.2-3 python3-numpy_1:1.19.5-1 python3-pandas_1.1.5+dfsg-2 python3-pandas-lib_1.1.5+dfsg-2 python3-patsy_0.5.2-2 python3-pil_8.1.2+dfsg-0.3 python3-pkg-resources_52.0.0-4 python3-pubsub_4.0.3-4 python3-pyparsing_2.4.7-1 python3-scipy_1.6.0-2 python3-setuptools_52.0.0-4 python3-six_1.16.0-2 python3-statsmodels_0.12.2-2+rpi1 python3-statsmodels-lib_0.12.2-2+rpi1 python3-tz_2021.3-1 python3.9_3.9.7-4+rpi1 python3.9-dev_3.9.7-4+rpi1 python3.9-minimal_3.9.7-4+rpi1 raspbian-archive-keyring_20120528.2 readline-common_8.1-2 rpcsvc-proto_1.4.2-4 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-tnseq-transit-dummy_0.invalid.0 sed_4.8-1 sensible-utils_0.0.17 sysvinit-utils_3.00-1 tar_1.34+dfsg-1 ttf-bitstream-vera_1.10-8.1 tzdata_2021a-1 util-linux_2.37.2-1 xz-utils_5.2.5-2 zlib1g_1:1.2.11.dfsg-2 zlib1g-dev_1:1.2.11.dfsg-2
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/tmp/dpkg-verify-sig.iqczZomf/trustedkeys.kbx': General error
gpgv: Signature made Tue Oct 12 14:30:26 2021 UTC
gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv: issuer "tille@debian.org"
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./tnseq-transit_3.2.2-1.dsc
dpkg-source: info: extracting tnseq-transit in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking tnseq-transit_3.2.2.orig.tar.gz
dpkg-source: info: unpacking tnseq-transit_3.2.2-1.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying skip_test_requiring_non_existing_input_data.patch
dpkg-source: info: applying fix_problematic_comparison.patch
Check disc space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=bookworm-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=bookworm-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=bookworm-staging-armhf-sbuild-bc7e2ff5-f54e-4d70-a317-08dda081fd1c
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=linux
USER=buildd
dpkg-buildpackage
-----------------
dpkg-buildpackage: info: source package tnseq-transit
dpkg-buildpackage: info: source version 3.2.2-1
dpkg-buildpackage: info: source distribution unstable
dpkg-source --before-build .
dpkg-buildpackage: info: host architecture armhf
debian/rules clean
dh clean --with python3 --buildsystem=pybuild
debian/rules override_dh_auto_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_clean
I: pybuild base:232: python3.9 setup.py clean
running clean
removing '/<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build' (and everything under it)
'build/bdist.linux-armhf' does not exist -- can't clean it
'build/scripts-3.9' does not exist -- can't clean it
rm -rf tests_invalid_data
rm -rf tnseq_transit.egg-info
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_autoreconf_clean -O--buildsystem=pybuild
dh_clean -O--buildsystem=pybuild
debian/rules binary-arch
dh binary-arch --with python3 --buildsystem=pybuild
dh_update_autotools_config -a -O--buildsystem=pybuild
dh_autoreconf -a -O--buildsystem=pybuild
debian/rules override_dh_auto_configure
make[1]: Entering directory '/<<PKGBUILDDIR>>'
mkdir -p tests_invalid_data
mv tests/H37Rv.fna tests_invalid_data
dh_auto_configure
I: pybuild base:232: python3.9 setup.py config
running config
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_auto_build -a -O--buildsystem=pybuild
I: pybuild base:232: /usr/bin/python3 setup.py build
running build
running build_py
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp
copying src/pytpp/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp
copying src/pytpp/__main__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp
copying src/pytpp/tpp_gui.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp
copying src/pytpp/tpp_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/__main__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/draw_trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/fileDisplay.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/images.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/norm_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/qcDisplay.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/stat_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/tnseq_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/transit_gui.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/transit_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
copying src/pytransit/view_trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/anova.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/binomial.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/corrplot.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/example.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/gi.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/griffin.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/gumbel.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/heatmap.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/hmm.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/norm.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/normalize.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/pathway_enrichment.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/rankproduct.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/resampling.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/tn5gaps.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/tnseq_stats.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/utest.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
copying src/pytransit/analysis/zinb.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert
copying src/pytransit/convert/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert
copying src/pytransit/convert/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert
copying src/pytransit/convert/gff_to_prot_table.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/combined_wig.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/igv.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/mean_counts.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
copying src/pytransit/export/prot_table.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export
running egg_info
creating tnseq_transit.egg-info
writing tnseq_transit.egg-info/PKG-INFO
writing dependency_links to tnseq_transit.egg-info/dependency_links.txt
writing entry points to tnseq_transit.egg-info/entry_points.txt
writing requirements to tnseq_transit.egg-info/requires.txt
writing top-level names to tnseq_transit.egg-info/top_level.txt
writing manifest file 'tnseq_transit.egg-info/SOURCES.txt'
reading manifest file 'tnseq_transit.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no files found matching 'VERSION'
warning: no files found matching '*.html' under directory 'src/pytransit/doc/build/html'
warning: no files found matching '*.png' under directory 'src/pytransit/doc/build/html/_images'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_modules'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_static'
writing manifest file 'tnseq_transit.egg-info/SOURCES.txt'
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/COG_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/GO_associated_Rvs-3-11-18.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/GO_associated_Rvs.csv -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/GO_term_names.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/GO_terms_for_each_Rv.obo-3-11-18.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/H37Rv.sanger_associated_RVS.csv -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/H37Rv_COG_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/H37Rv_GO_terms.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/H37Rv_sanger_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/README.md -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep3.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/cholesterol_glycerol_combined.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/gene_ontology.1_2.3-11-18.obo -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg_covar.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg_interactions.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/sanger_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
copying src/pytransit/data/smeg_GO_terms.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/BCG.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/BCG.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37Rv.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37Rv.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD_mod3.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37RvMA2.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/H37RvMA2.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/genomes.html -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/mc2_155_tamu.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
copying src/pytransit/genomes/mc2_155_tamu.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes
debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_test -- --system=custom --test-args="PYTHONPATH=tests {interpreter} -m unittest -v tests/*.py"
I: pybuild base:232: PYTHONPATH=tests python3.9 -m unittest -v tests/*.py
test_Binomial (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(self.annotation):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
####################
tests.test_analysis_methods.TestMethods.test_Binomial
####################
[binomial] Starting Binomial Method
[binomial] Getting Data
[binomial] Setting Parameters
[binomial] Setting Initial Values
[binomial] Running Binomial Method... 0.2%
[binomial] Running Binomial Method... 0.3%
[binomial] Running Binomial Method... 0.4%
[binomial] Running Binomial Method... 0.5%
[binomial] Running Binomial Method... 0.5%
[binomial] Running Binomial Method... 0.6%
[binomial] Running Binomial Method... 0.7%
[binomial] Running Binomial Method... 0.8%
[binomial] Running Binomial Method... 0.9%
[binomial] Running Binomial Method... 1.0%
[binomial] Running Binomial Method... 1.1%
[binomial] Running Binomial Method... 1.2%
[binomial] Running Binomial Method... 1.3%
[binomial] Running Binomial Method... 1.4%
[binomial] Running Binomial Method... 1.5%
[binomial] Running Binomial Method... 1.5%
[binomial] Running Binomial Method... 1.6%
[binomial] Running Binomial Method... 1.7%
[binomial] Running Binomial Method... 1.8%
[binomial] Running Binomial Method... 1.9%
[binomial] Running Binomial Method... 2.0%
[binomial] Running Binomial Method... 2.1%
[binomial] Running Binomial Method... 2.2%
[binomial] Running Binomial Method... 2.3%
[binomial] Running Binomial Method... 2.4%
[binomial] Running Binomial Method... 2.5%
[binomial] Running Binomial Method... 2.5%
[binomial] Running Binomial Method... 2.6%
[binomial] Running Binomial Method... 2.7%
[binomial] Running Binomial Method... 2.8%
[binomial] Running Binomial Method... 2.9%
[binomial] Running Binomial Method... 3.0%
[binomial] Running Binomial Method... 3.1%
[binomial] Running Binomial Method... 3.2%
[binomial] Running Binomial Method... 3.3%
[binomial] Running Binomial Method... 3.4%
[binomial] Running Binomial Method... 3.5%
[binomial] Running Binomial Method... 3.5%
[binomial] Running Binomial Method... 3.6%
[binomial] Running Binomial Method... 3.7%
[binomial] Running Binomial Method... 3.8%
[binomial] Running Binomial Method... 3.9%
[binomial] Running Binomial Method... 4.0%
[binomial] Running Binomial Method... 4.1%
[binomial] Running Binomial Method... 4.2%
[binomial] Running Binomial Method... 4.3%
[binomial] Running Binomial Method... 4.4%
[binomial] Running Binomial Method... 4.5%
[binomial] Running Binomial Method... 4.5%
[binomial] Running Binomial Method... 4.6%
[binomial] Running Binomial Method... 4.7%
[binomial] Running Binomial Method... 4.8%
[binomial] Running Binomial Method... 4.9%
[binomial] Running Binomial Method... 5.0%
[binomial] Running Binomial Method... 5.1%
[binomial] Running Binomial Method... 5.2%
[binomial] Running Binomial Method... 5.3%
[binomial] Running Binomial Method... 5.4%
[binomial] Running Binomial Method... 5.5%
[binomial] Running Binomial Method... 5.5%
[binomial] Running Binomial Method... 5.6%
[binomial] Running Binomial Method... 5.7%
[binomial] Running Binomial Method... 5.8%
[binomial] Running Binomial Method... 5.9%
[binomial] Running Binomial Method... 6.0%
[binomial] Running Binomial Method... 6.1%
[binomial] Running Binomial Method... 6.2%
[binomial] Running Binomial Method... 6.3%
[binomial] Running Binomial Method... 6.4%
[binomial] Running Binomial Method... 6.5%
[binomial] Running Binomial Method... 6.5%
[binomial] Running Binomial Method... 6.6%
[binomial] Running Binomial Method... 6.7%
[binomial] Running Binomial Method... 6.8%
[binomial] Running Binomial Method... 6.9%
[binomial] Running Binomial Method... 7.0%
[binomial] Running Binomial Method... 7.1%
[binomial] Running Binomial Method... 7.2%
[binomial] Running Binomial Method... 7.3%
[binomial] Running Binomial Method... 7.4%
[binomial] Running Binomial Method... 7.5%
[binomial] Running Binomial Method... 7.5%
[binomial] Running Binomial Method... 7.6%
[binomial] Running Binomial Method... 7.7%
[binomial] Running Binomial Method... 7.8%
[binomial] Running Binomial Method... 7.9%
[binomial] Running Binomial Method... 8.0%
[binomial] Running Binomial Method... 8.1%
[binomial] Running Binomial Method... 8.2%
[binomial] Running Binomial Method... 8.3%
[binomial] Running Binomial Method... 8.4%
[binomial] Running Binomial Method... 8.5%
[binomial] Running Binomial Method... 8.5%
[binomial] Running Binomial Method... 8.6%
[binomial] Running Binomial Method... 8.7%
[binomial] Running Binomial Method... 8.8%
[binomial] Running Binomial Method... 8.9%
[binomial] Running Binomial Method... 9.0%
[binomial] Running Binomial Method... 9.1%
[binomial] Running Binomial Method... 9.2%
[binomial] Running Binomial Method... 9.3%
[binomial] Running Binomial Method... 9.4%
[binomial] Running Binomial Method... 9.5%
[binomial] Running Binomial Method... 9.5%
[binomial] Running Binomial Method... 9.6%
[binomial] Running Binomial Method... 9.7%
[binomial] Running Binomial Method... 9.8%
[binomial] Running Binomial Method... 9.9%
[binomial] Running Binomial Method... 10.0%
[binomial] Running Binomial Method... 10.1%
[binomial] Running Binomial Method... 10.2%
[binomial] Running Binomial Method... 10.3%
[binomial] Running Binomial Method... 10.4%
[binomial] Running Binomial Method... 10.5%
[binomial] Running Binomial Method... 10.5%
[binomial] Running Binomial Method... 10.6%
[binomial] Running Binomial Method... 10.7%
[binomial] Running Binomial Method... 10.8%
[binomial] Running Binomial Method... 10.9%
[binomial] Running Binomial Method... 11.0%
[binomial] Running Binomial Method... 11.1%
[binomial] Running Binomial Method... 11.2%
[binomial] Running Binomial Method... 11.3%
[binomial] Running Binomial Method... 11.4%
[binomial] Running Binomial Method... 11.5%
[binomial] Running Binomial Method... 11.5%
[binomial] Running Binomial Method... 11.6%
[binomial] Running Binomial Method... 11.7%
[binomial] Running Binomial Method... 11.8%
[binomial] Running Binomial Method... 11.9%
[binomial] Running Binomial Method... 12.0%
[binomial] Running Binomial Method... 12.1%
[binomial] Running Binomial Method... 12.2%
[binomial] Running Binomial Method... 12.3%
[binomial] Running Binomial Method... 12.4%
[binomial] Running Binomial Method... 12.5%
[binomial] Running Binomial Method... 12.5%
[binomial] Running Binomial Method... 12.6%
[binomial] Running Binomial Method... 12.7%
[binomial] Running Binomial Method... 12.8%
[binomial] Running Binomial Method... 12.9%
[binomial] Running Binomial Method... 13.0%
[binomial] Running Binomial Method... 13.1%
[binomial] Running Binomial Method... 13.2%
[binomial] Running Binomial Method... 13.3%
[binomial] Running Binomial Method... 13.4%
[binomial] Running Binomial Method... 13.5%
[binomial] Running Binomial Method... 13.5%
[binomial] Running Binomial Method... 13.6%
[binomial] Running Binomial Method... 13.7%
[binomial] Running Binomial Method... 13.8%
[binomial] Running Binomial Method... 13.9%
[binomial] Running Binomial Method... 14.0%
[binomial] Running Binomial Method... 14.1%
[binomial] Running Binomial Method... 14.2%
[binomial] Running Binomial Method... 14.3%
[binomial] Running Binomial Method... 14.4%
[binomial] Running Binomial Method... 14.5%
[binomial] Running Binomial Method... 14.5%
[binomial] Running Binomial Method... 14.6%
[binomial] Running Binomial Method... 14.7%
[binomial] Running Binomial Method... 14.8%
[binomial] Running Binomial Method... 14.9%
[binomial] Running Binomial Method... 15.0%
[binomial] Running Binomial Method... 15.1%
[binomial] Running Binomial Method... 15.2%
[binomial] Running Binomial Method... 15.3%
[binomial] Running Binomial Method... 15.4%
[binomial] Running Binomial Method... 15.5%
[binomial] Running Binomial Method... 15.5%
[binomial] Running Binomial Method... 15.6%
[binomial] Running Binomial Method... 15.7%
[binomial] Running Binomial Method... 15.8%
[binomial] Running Binomial Method... 15.9%
[binomial] Running Binomial Method... 16.0%
[binomial] Running Binomial Method... 16.1%
[binomial] Running Binomial Method... 16.2%
[binomial] Running Binomial Method... 16.3%
[binomial] Running Binomial Method... 16.4%
[binomial] Running Binomial Method... 16.5%
[binomial] Running Binomial Method... 16.5%
[binomial] Running Binomial Method... 16.6%
[binomial] Running Binomial Method... 16.7%
[binomial] Running Binomial Method... 16.8%
[binomial] Running Binomial Method... 16.9%
[binomial] Running Binomial Method... 17.0%
[binomial] Running Binomial Method... 17.1%
[binomial] Running Binomial Method... 17.2%
[binomial] Running Binomial Method... 17.3%
[binomial] Running Binomial Method... 17.4%
[binomial] Running Binomial Method... 17.5%
[binomial] Running Binomial Method... 17.5%
[binomial] Running Binomial Method... 17.6%
[binomial] Running Binomial Method... 17.7%
[binomial] Running Binomial Method... 17.8%
[binomial] Running Binomial Method... 17.9%
[binomial] Running Binomial Method... 18.0%
[binomial] Running Binomial Method... 18.1%
[binomial] Running Binomial Method... 18.2%
[binomial] Running Binomial Method... 18.3%
[binomial] Running Binomial Method... 18.4%
[binomial] Running Binomial Method... 18.5%
[binomial] Running Binomial Method... 18.5%
[binomial] Running Binomial Method... 18.6%
[binomial] Running Binomial Method... 18.7%
[binomial] Running Binomial Method... 18.8%
[binomial] Running Binomial Method... 18.9%
[binomial] Running Binomial Method... 19.0%
[binomial] Running Binomial Method... 19.1%
[binomial] Running Binomial Method... 19.2%
[binomial] Running Binomial Method... 19.3%
[binomial] Running Binomial Method... 19.4%
[binomial] Running Binomial Method... 19.5%
[binomial] Running Binomial Method... 19.5%
[binomial] Running Binomial Method... 19.6%
[binomial] Running Binomial Method... 19.7%
[binomial] Running Binomial Method... 19.8%
[binomial] Running Binomial Method... 19.9%
[binomial] Running Binomial Method... 20.0%
[binomial] Running Binomial Method... 20.1%
[binomial] Running Binomial Method... 20.2%
[binomial] Running Binomial Method... 20.3%
[binomial] Running Binomial Method... 20.4%
[binomial] Running Binomial Method... 20.5%
[binomial] Running Binomial Method... 20.5%
[binomial] Running Binomial Method... 20.6%
[binomial] Running Binomial Method... 20.7%
[binomial] Running Binomial Method... 20.8%
[binomial] Running Binomial Method... 20.9%
[binomial] Running Binomial Method... 21.0%
[binomial] Running Binomial Method... 21.1%
[binomial] Running Binomial Method... 21.2%
[binomial] Running Binomial Method... 21.3%
[binomial] Running Binomial Method... 21.4%
[binomial] Running Binomial Method... 21.5%
[binomial] Running Binomial Method... 21.5%
[binomial] Running Binomial Method... 21.6%
[binomial] Running Binomial Method... 21.7%
[binomial] Running Binomial Method... 21.8%
[binomial] Running Binomial Method... 21.9%
[binomial] Running Binomial Method... 22.0%
[binomial] Running Binomial Method... 22.1%
[binomial] Running Binomial Method... 22.2%
[binomial] Running Binomial Method... 22.3%
[binomial] Running Binomial Method... 22.4%
[binomial] Running Binomial Method... 22.5%
[binomial] Running Binomial Method... 22.5%
[binomial] Running Binomial Method... 22.6%
[binomial] Running Binomial Method... 22.7%
[binomial] Running Binomial Method... 22.8%
[binomial] Running Binomial Method... 22.9%
[binomial] Running Binomial Method... 23.0%
[binomial] Running Binomial Method... 23.1%
[binomial] Running Binomial Method... 23.2%
[binomial] Running Binomial Method... 23.3%
[binomial] Running Binomial Method... 23.4%
[binomial] Running Binomial Method... 23.5%
[binomial] Running Binomial Method... 23.5%
[binomial] Running Binomial Method... 23.6%
[binomial] Running Binomial Method... 23.7%
[binomial] Running Binomial Method... 23.8%
[binomial] Running Binomial Method... 23.9%
[binomial] Running Binomial Method... 24.0%
[binomial] Running Binomial Method... 24.1%
[binomial] Running Binomial Method... 24.2%
[binomial] Running Binomial Method... 24.3%
[binomial] Running Binomial Method... 24.4%
[binomial] Running Binomial Method... 24.5%
[binomial] Running Binomial Method... 24.5%
[binomial] Running Binomial Method... 24.6%
[binomial] Running Binomial Method... 24.7%
[binomial] Running Binomial Method... 24.8%
[binomial] Running Binomial Method... 24.9%
[binomial] Running Binomial Method... 25.0%
[binomial] Running Binomial Method... 25.1%
[binomial] Running Binomial Method... 25.2%
[binomial] Running Binomial Method... 25.3%
[binomial] Running Binomial Method... 25.4%
[binomial] Running Binomial Method... 25.5%
[binomial] Running Binomial Method... 25.5%
[binomial] Running Binomial Method... 25.6%
[binomial] Running Binomial Method... 25.7%
[binomial] Running Binomial Method... 25.8%
[binomial] Running Binomial Method... 25.9%
[binomial] Running Binomial Method... 26.0%
[binomial] Running Binomial Method... 26.1%
[binomial] Running Binomial Method... 26.2%
[binomial] Running Binomial Method... 26.3%
[binomial] Running Binomial Method... 26.4%
[binomial] Running Binomial Method... 26.5%
[binomial] Running Binomial Method... 26.5%
[binomial] Running Binomial Method... 26.6%
[binomial] Running Binomial Method... 26.7%
[binomial] Running Binomial Method... 26.8%
[binomial] Running Binomial Method... 26.9%
[binomial] Running Binomial Method... 27.0%
[binomial] Running Binomial Method... 27.1%
[binomial] Running Binomial Method... 27.2%
[binomial] Running Binomial Method... 27.3%
[binomial] Running Binomial Method... 27.4%
[binomial] Running Binomial Method... 27.5%
[binomial] Running Binomial Method... 27.5%
[binomial] Running Binomial Method... 27.6%
[binomial] Running Binomial Method... 27.7%
[binomial] Running Binomial Method... 27.8%
[binomial] Running Binomial Method... 27.9%
[binomial] Running Binomial Method... 28.0%
[binomial] Running Binomial Method... 28.1%
[binomial] Running Binomial Method... 28.2%
[binomial] Running Binomial Method... 28.3%
[binomial] Running Binomial Method... 28.4%
[binomial] Running Binomial Method... 28.5%
[binomial] Running Binomial Method... 28.5%
[binomial] Running Binomial Method... 28.6%
[binomial] Running Binomial Method... 28.7%
[binomial] Running Binomial Method... 28.8%
[binomial] Running Binomial Method... 28.9%
[binomial] Running Binomial Method... 29.0%
[binomial] Running Binomial Method... 29.1%
[binomial] Running Binomial Method... 29.2%
[binomial] Running Binomial Method... 29.3%
[binomial] Running Binomial Method... 29.4%
[binomial] Running Binomial Method... 29.5%
[binomial] Running Binomial Method... 29.5%
[binomial] Running Binomial Method... 29.6%
[binomial] Running Binomial Method... 29.7%
[binomial] Running Binomial Method... 29.8%
[binomial] Running Binomial Method... 29.9%
[binomial] Running Binomial Method... 30.0%
[binomial] Running Binomial Method... 30.1%
[binomial] Running Binomial Method... 30.2%
[binomial] Running Binomial Method... 30.3%
[binomial] Running Binomial Method... 30.4%
[binomial] Running Binomial Method... 30.5%
[binomial] Running Binomial Method... 30.5%
[binomial] Running Binomial Method... 30.6%
[binomial] Running Binomial Method... 30.7%
[binomial] Running Binomial Method... 30.8%
[binomial] Running Binomial Method... 30.9%
[binomial] Running Binomial Method... 31.0%
[binomial] Running Binomial Method... 31.1%
[binomial] Running Binomial Method... 31.2%
[binomial] Running Binomial Method... 31.3%
[binomial] Running Binomial Method... 31.4%
[binomial] Running Binomial Method... 31.5%
[binomial] Running Binomial Method... 31.5%
[binomial] Running Binomial Method... 31.6%
[binomial] Running Binomial Method... 31.7%
[binomial] Running Binomial Method... 31.8%
[binomial] Running Binomial Method... 31.9%
[binomial] Running Binomial Method... 32.0%
[binomial] Running Binomial Method... 32.1%
[binomial] Running Binomial Method... 32.2%
[binomial] Running Binomial Method... 32.3%
[binomial] Running Binomial Method... 32.4%
[binomial] Running Binomial Method... 32.5%
[binomial] Running Binomial Method... 32.5%
[binomial] Running Binomial Method... 32.6%
[binomial] Running Binomial Method... 32.7%
[binomial] Running Binomial Method... 32.8%
[binomial] Running Binomial Method... 32.9%
[binomial] Running Binomial Method... 33.0%
[binomial] Running Binomial Method... 33.1%
[binomial] Running Binomial Method... 33.2%
[binomial] Running Binomial Method... 33.3%
[binomial] Running Binomial Method... 33.4%
[binomial] Running Binomial Method... 33.5%
[binomial] Running Binomial Method... 33.5%
[binomial] Running Binomial Method... 33.6%
[binomial] Running Binomial Method... 33.7%
[binomial] Running Binomial Method... 33.8%
[binomial] Running Binomial Method... 33.9%
[binomial] Running Binomial Method... 34.0%
[binomial] Running Binomial Method... 34.1%
[binomial] Running Binomial Method... 34.2%
[binomial] Running Binomial Method... 34.3%
[binomial] Running Binomial Method... 34.4%
[binomial] Running Binomial Method... 34.5%
[binomial] Running Binomial Method... 34.5%
[binomial] Running Binomial Method... 34.6%
[binomial] Running Binomial Method... 34.7%
[binomial] Running Binomial Method... 34.8%
[binomial] Running Binomial Method... 34.9%
[binomial] Running Binomial Method... 35.0%
[binomial] Running Binomial Method... 35.1%
[binomial] Running Binomial Method... 35.2%
[binomial] Running Binomial Method... 35.3%
[binomial] Running Binomial Method... 35.4%
[binomial] Running Binomial Method... 35.5%
[binomial] Running Binomial Method... 35.5%
[binomial] Running Binomial Method... 35.6%
[binomial] Running Binomial Method... 35.7%
[binomial] Running Binomial Method... 35.8%
[binomial] Running Binomial Method... 35.9%
[binomial] Running Binomial Method... 36.0%
[binomial] Running Binomial Method... 36.1%
[binomial] Running Binomial Method... 36.2%
[binomial] Running Binomial Method... 36.3%
[binomial] Running Binomial Method... 36.4%
[binomial] Running Binomial Method... 36.5%
[binomial] Running Binomial Method... 36.5%
[binomial] Running Binomial Method... 36.6%
[binomial] Running Binomial Method... 36.7%
[binomial] Running Binomial Method... 36.8%
[binomial] Running Binomial Method... 36.9%
[binomial] Running Binomial Method... 37.0%
[binomial] Running Binomial Method... 37.1%
[binomial] Running Binomial Method... 37.2%
[binomial] Running Binomial Method... 37.3%
[binomial] Running Binomial Method... 37.4%
[binomial] Running Binomial Method... 37.5%
[binomial] Running Binomial Method... 37.5%
[binomial] Running Binomial Method... 37.6%
[binomial] Running Binomial Method... 37.7%
[binomial] Running Binomial Method... 37.8%
[binomial] Running Binomial Method... 37.9%
[binomial] Running Binomial Method... 38.0%
[binomial] Running Binomial Method... 38.1%
[binomial] Running Binomial Method... 38.2%
[binomial] Running Binomial Method... 38.3%
[binomial] Running Binomial Method... 38.4%
[binomial] Running Binomial Method... 38.5%
[binomial] Running Binomial Method... 38.5%
[binomial] Running Binomial Method... 38.6%
[binomial] Running Binomial Method... 38.7%
[binomial] Running Binomial Method... 38.8%
[binomial] Running Binomial Method... 38.9%
[binomial] Running Binomial Method... 39.0%
[binomial] Running Binomial Method... 39.1%
[binomial] Running Binomial Method... 39.2%
[binomial] Running Binomial Method... 39.3%
[binomial] Running Binomial Method... 39.4%
[binomial] Running Binomial Method... 39.5%
[binomial] Running Binomial Method... 39.5%
[binomial] Running Binomial Method... 39.6%
[binomial] Running Binomial Method... 39.7%
[binomial] Running Binomial Method... 39.8%
[binomial] Running Binomial Method... 39.9%
[binomial] Running Binomial Method... 40.0%
[binomial] Running Binomial Method... 40.1%
[binomial] Running Binomial Method... 40.2%
[binomial] Running Binomial Method... 40.3%
[binomial] Running Binomial Method... 40.4%
[binomial] Running Binomial Method... 40.5%
[binomial] Running Binomial Method... 40.5%
[binomial] Running Binomial Method... 40.6%
[binomial] Running Binomial Method... 40.7%
[binomial] Running Binomial Method... 40.8%
[binomial] Running Binomial Method... 40.9%
[binomial] Running Binomial Method... 41.0%
[binomial] Running Binomial Method... 41.1%
[binomial] Running Binomial Method... 41.2%
[binomial] Running Binomial Method... 41.3%
[binomial] Running Binomial Method... 41.4%
[binomial] Running Binomial Method... 41.5%
[binomial] Running Binomial Method... 41.5%
[binomial] Running Binomial Method... 41.6%
[binomial] Running Binomial Method... 41.7%
[binomial] Running Binomial Method... 41.8%
[binomial] Running Binomial Method... 41.9%
[binomial] Running Binomial Method... 42.0%
[binomial] Running Binomial Method... 42.1%
[binomial] Running Binomial Method... 42.2%
[binomial] Running Binomial Method... 42.3%
[binomial] Running Binomial Method... 42.4%
[binomial] Running Binomial Method... 42.5%
[binomial] Running Binomial Method... 42.5%
[binomial] Running Binomial Method... 42.6%
[binomial] Running Binomial Method... 42.7%
[binomial] Running Binomial Method... 42.8%
[binomial] Running Binomial Method... 42.9%
[binomial] Running Binomial Method... 43.0%
[binomial] Running Binomial Method... 43.1%
[binomial] Running Binomial Method... 43.2%
[binomial] Running Binomial Method... 43.3%
[binomial] Running Binomial Method... 43.4%
[binomial] Running Binomial Method... 43.5%
[binomial] Running Binomial Method... 43.5%
[binomial] Running Binomial Method... 43.6%
[binomial] Running Binomial Method... 43.7%
[binomial] Running Binomial Method... 43.8%
[binomial] Running Binomial Method... 43.9%
[binomial] Running Binomial Method... 44.0%
[binomial] Running Binomial Method... 44.1%
[binomial] Running Binomial Method... 44.2%
[binomial] Running Binomial Method... 44.3%
[binomial] Running Binomial Method... 44.4%
[binomial] Running Binomial Method... 44.5%
[binomial] Running Binomial Method... 44.5%
[binomial] Running Binomial Method... 44.6%
[binomial] Running Binomial Method... 44.7%
[binomial] Running Binomial Method... 44.8%
[binomial] Running Binomial Method... 44.9%
[binomial] Running Binomial Method... 45.0%
[binomial] Running Binomial Method... 45.1%
[binomial] Running Binomial Method... 45.2%
[binomial] Running Binomial Method... 45.3%
[binomial] Running Binomial Method... 45.4%
[binomial] Running Binomial Method... 45.5%
[binomial] Running Binomial Method... 45.5%
[binomial] Running Binomial Method... 45.6%
[binomial] Running Binomial Method... 45.7%
[binomial] Running Binomial Method... 45.8%
[binomial] Running Binomial Method... 45.9%
[binomial] Running Binomial Method... 46.0%
[binomial] Running Binomial Method... 46.1%
[binomial] Running Binomial Method... 46.2%
[binomial] Running Binomial Method... 46.3%
[binomial] Running Binomial Method... 46.4%
[binomial] Running Binomial Method... 46.5%
[binomial] Running Binomial Method... 46.5%
[binomial] Running Binomial Method... 46.6%
[binomial] Running Binomial Method... 46.7%
[binomial] Running Binomial Method... 46.8%
[binomial] Running Binomial Method... 46.9%
[binomial] Running Binomial Method... 47.0%
[binomial] Running Binomial Method... 47.1%
[binomial] Running Binomial Method... 47.2%
[binomial] Running Binomial Method... 47.3%
[binomial] Running Binomial Method... 47.4%
[binomial] Running Binomial Method... 47.5%
[binomial] Running Binomial Method... 47.5%
[binomial] Running Binomial Method... 47.6%
[binomial] Running Binomial Method... 47.7%
[binomial] Running Binomial Method... 47.8%
[binomial] Running Binomial Method... 47.9%
[binomial] Running Binomial Method... 48.0%
[binomial] Running Binomial Method... 48.1%
[binomial] Running Binomial Method... 48.2%
[binomial] Running Binomial Method... 48.3%
[binomial] Running Binomial Method... 48.4%
[binomial] Running Binomial Method... 48.5%
[binomial] Running Binomial Method... 48.5%
[binomial] Running Binomial Method... 48.6%
[binomial] Running Binomial Method... 48.7%
[binomial] Running Binomial Method... 48.8%
[binomial] Running Binomial Method... 48.9%
[binomial] Running Binomial Method... 49.0%
[binomial] Running Binomial Method... 49.1%
[binomial] Running Binomial Method... 49.2%
[binomial] Running Binomial Method... 49.3%
[binomial] Running Binomial Method... 49.4%
[binomial] Running Binomial Method... 49.5%
[binomial] Running Binomial Method... 49.5%
[binomial] Running Binomial Method... 49.6%
[binomial] Running Binomial Method... 49.7%
[binomial] Running Binomial Method... 49.8%
[binomial] Running Binomial Method... 49.9%
[binomial] Running Binomial Method... 50.0%
[binomial] Running Binomial Method... 50.1%
[binomial] Running Binomial Method... 50.2%
[binomial] Running Binomial Method... 50.3%
[binomial] Running Binomial Method... 50.4%
[binomial] Running Binomial Method... 50.5%
[binomial] Running Binomial Method... 50.5%
[binomial] Running Binomial Method... 50.6%
[binomial] Running Binomial Method... 50.7%
[binomial] Running Binomial Method... 50.8%
[binomial] Running Binomial Method... 50.9%
[binomial] Running Binomial Method... 51.0%
[binomial] Running Binomial Method... 51.1%
[binomial] Running Binomial Method... 51.2%
[binomial] Running Binomial Method... 51.3%
[binomial] Running Binomial Method... 51.4%
[binomial] Running Binomial Method... 51.5%
[binomial] Running Binomial Method... 51.5%
[binomial] Running Binomial Method... 51.6%
[binomial] Running Binomial Method... 51.7%
[binomial] Running Binomial Method... 51.8%
[binomial] Running Binomial Method... 51.9%
[binomial] Running Binomial Method... 52.0%
[binomial] Running Binomial Method... 52.1%
[binomial] Running Binomial Method... 52.2%
[binomial] Running Binomial Method... 52.3%
[binomial] Running Binomial Method... 52.4%
[binomial] Running Binomial Method... 52.5%
[binomial] Running Binomial Method... 52.5%
[binomial] Running Binomial Method... 52.6%
[binomial] Running Binomial Method... 52.7%
[binomial] Running Binomial Method... 52.8%
[binomial] Running Binomial Method... 52.9%
[binomial] Running Binomial Method... 53.0%
[binomial] Running Binomial Method... 53.1%
[binomial] Running Binomial Method... 53.2%
[binomial] Running Binomial Method... 53.3%
[binomial] Running Binomial Method... 53.4%
[binomial] Running Binomial Method... 53.5%
[binomial] Running Binomial Method... 53.5%
[binomial] Running Binomial Method... 53.6%
[binomial] Running Binomial Method... 53.7%
[binomial] Running Binomial Method... 53.8%
[binomial] Running Binomial Method... 53.9%
[binomial] Running Binomial Method... 54.0%
[binomial] Running Binomial Method... 54.1%
[binomial] Running Binomial Method... 54.2%
[binomial] Running Binomial Method... 54.3%
[binomial] Running Binomial Method... 54.4%
[binomial] Running Binomial Method... 54.5%
[binomial] Running Binomial Method... 54.5%
[binomial] Running Binomial Method... 54.6%
[binomial] Running Binomial Method... 54.7%
[binomial] Running Binomial Method... 54.8%
[binomial] Running Binomial Method... 54.9%
[binomial] Running Binomial Method... 55.0%
[binomial] Running Binomial Method... 55.1%
[binomial] Running Binomial Method... 55.2%
[binomial] Running Binomial Method... 55.3%
[binomial] Running Binomial Method... 55.4%
[binomial] Running Binomial Method... 55.5%
[binomial] Running Binomial Method... 55.5%
[binomial] Running Binomial Method... 55.6%
[binomial] Running Binomial Method... 55.7%
[binomial] Running Binomial Method... 55.8%
[binomial] Running Binomial Method... 55.9%
[binomial] Running Binomial Method... 56.0%
[binomial] Running Binomial Method... 56.1%
[binomial] Running Binomial Method... 56.2%
[binomial] Running Binomial Method... 56.3%
[binomial] Running Binomial Method... 56.4%
[binomial] Running Binomial Method... 56.5%
[binomial] Running Binomial Method... 56.5%
[binomial] Running Binomial Method... 56.6%
[binomial] Running Binomial Method... 56.7%
[binomial] Running Binomial Method... 56.8%
[binomial] Running Binomial Method... 56.9%
[binomial] Running Binomial Method... 57.0%
[binomial] Running Binomial Method... 57.1%
[binomial] Running Binomial Method... 57.2%
[binomial] Running Binomial Method... 57.3%
[binomial] Running Binomial Method... 57.4%
[binomial] Running Binomial Method... 57.5%
[binomial] Running Binomial Method... 57.5%
[binomial] Running Binomial Method... 57.6%
[binomial] Running Binomial Method... 57.7%
[binomial] Running Binomial Method... 57.8%
[binomial] Running Binomial Method... 57.9%
[binomial] Running Binomial Method... 58.0%
[binomial] Running Binomial Method... 58.1%
[binomial] Running Binomial Method... 58.2%
[binomial] Running Binomial Method... 58.3%
[binomial] Running Binomial Method... 58.4%
[binomial] Running Binomial Method... 58.5%
[binomial] Running Binomial Method... 58.5%
[binomial] Running Binomial Method... 58.6%
[binomial] Running Binomial Method... 58.7%
[binomial] Running Binomial Method... 58.8%
[binomial] Running Binomial Method... 58.9%
[binomial] Running Binomial Method... 59.0%
[binomial] Running Binomial Method... 59.1%
[binomial] Running Binomial Method... 59.2%
[binomial] Running Binomial Method... 59.3%
[binomial] Running Binomial Method... 59.4%
[binomial] Running Binomial Method... 59.5%
[binomial] Running Binomial Method... 59.5%
[binomial] Running Binomial Method... 59.6%
[binomial] Running Binomial Method... 59.7%
[binomial] Running Binomial Method... 59.8%
[binomial] Running Binomial Method... 59.9%
[binomial] Running Binomial Method... 60.0%
[binomial] Running Binomial Method... 60.1%
[binomial] Running Binomial Method... 60.2%
[binomial] Running Binomial Method... 60.3%
[binomial] Running Binomial Method... 60.4%
[binomial] Running Binomial Method... 60.5%
[binomial] Running Binomial Method... 60.5%
[binomial] Running Binomial Method... 60.6%
[binomial] Running Binomial Method... 60.7%
[binomial] Running Binomial Method... 60.8%
[binomial] Running Binomial Method... 60.9%
[binomial] Running Binomial Method... 61.0%
[binomial] Running Binomial Method... 61.1%
[binomial] Running Binomial Method... 61.2%
[binomial] Running Binomial Method... 61.3%
[binomial] Running Binomial Method... 61.4%
[binomial] Running Binomial Method... 61.5%
[binomial] Running Binomial Method... 61.5%
[binomial] Running Binomial Method... 61.6%
[binomial] Running Binomial Method... 61.7%
[binomial] Running Binomial Method... 61.8%
[binomial] Running Binomial Method... 61.9%
[binomial] Running Binomial Method... 62.0%
[binomial] Running Binomial Method... 62.1%
[binomial] Running Binomial Method... 62.2%
[binomial] Running Binomial Method... 62.3%
[binomial] Running Binomial Method... 62.4%
[binomial] Running Binomial Method... 62.5%
[binomial] Running Binomial Method... 62.5%
[binomial] Running Binomial Method... 62.6%
[binomial] Running Binomial Method... 62.7%
[binomial] Running Binomial Method... 62.8%
[binomial] Running Binomial Method... 62.9%
[binomial] Running Binomial Method... 63.0%
[binomial] Running Binomial Method... 63.1%
[binomial] Running Binomial Method... 63.2%
[binomial] Running Binomial Method... 63.3%
[binomial] Running Binomial Method... 63.4%
[binomial] Running Binomial Method... 63.5%
[binomial] Running Binomial Method... 63.5%
[binomial] Running Binomial Method... 63.6%
[binomial] Running Binomial Method... 63.7%
[binomial] Running Binomial Method... 63.8%
[binomial] Running Binomial Method... 63.9%
[binomial] Running Binomial Method... 64.0%
[binomial] Running Binomial Method... 64.1%
[binomial] Running Binomial Method... 64.2%
[binomial] Running Binomial Method... 64.3%
[binomial] Running Binomial Method... 64.4%
[binomial] Running Binomial Method... 64.5%
[binomial] Running Binomial Method... 64.5%
[binomial] Running Binomial Method... 64.6%
[binomial] Running Binomial Method... 64.7%
[binomial] Running Binomial Method... 64.8%
[binomial] Running Binomial Method... 64.9%
[binomial] Running Binomial Method... 65.0%
[binomial] Running Binomial Method... 65.1%
[binomial] Running Binomial Method... 65.2%
[binomial] Running Binomial Method... 65.3%
[binomial] Running Binomial Method... 65.4%
[binomial] Running Binomial Method... 65.5%
[binomial] Running Binomial Method... 65.5%
[binomial] Running Binomial Method... 65.6%
[binomial] Running Binomial Method... 65.7%
[binomial] Running Binomial Method... 65.8%
[binomial] Running Binomial Method... 65.9%
[binomial] Running Binomial Method... 66.0%
[binomial] Running Binomial Method... 66.1%
[binomial] Running Binomial Method... 66.2%
[binomial] Running Binomial Method... 66.3%
[binomial] Running Binomial Method... 66.4%
[binomial] Running Binomial Method... 66.5%
[binomial] Running Binomial Method... 66.5%
[binomial] Running Binomial Method... 66.6%
[binomial] Running Binomial Method... 66.7%
[binomial] Running Binomial Method... 66.8%
[binomial] Running Binomial Method... 66.9%
[binomial] Running Binomial Method... 67.0%
[binomial] Running Binomial Method... 67.1%
[binomial] Running Binomial Method... 67.2%
[binomial] Running Binomial Method... 67.3%
[binomial] Running Binomial Method... 67.4%
[binomial] Running Binomial Method... 67.5%
[binomial] Running Binomial Method... 67.5%
[binomial] Running Binomial Method... 67.6%
[binomial] Running Binomial Method... 67.7%
[binomial] Running Binomial Method... 67.8%
[binomial] Running Binomial Method... 67.9%
[binomial] Running Binomial Method... 68.0%
[binomial] Running Binomial Method... 68.1%
[binomial] Running Binomial Method... 68.2%
[binomial] Running Binomial Method... 68.3%
[binomial] Running Binomial Method... 68.4%
[binomial] Running Binomial Method... 68.5%
[binomial] Running Binomial Method... 68.5%
[binomial] Running Binomial Method... 68.6%
[binomial] Running Binomial Method... 68.7%
[binomial] Running Binomial Method... 68.8%
[binomial] Running Binomial Method... 68.9%
[binomial] Running Binomial Method... 69.0%
[binomial] Running Binomial Method... 69.1%
[binomial] Running Binomial Method... 69.2%
[binomial] Running Binomial Method... 69.3%
[binomial] Running Binomial Method... 69.4%
[binomial] Running Binomial Method... 69.5%
[binomial] Running Binomial Method... 69.5%
[binomial] Running Binomial Method... 69.6%
[binomial] Running Binomial Method... 69.7%
[binomial] Running Binomial Method... 69.8%
[binomial] Running Binomial Method... 69.9%
[binomial] Running Binomial Method... 70.0%
[binomial] Running Binomial Method... 70.1%
[binomial] Running Binomial Method... 70.2%
[binomial] Running Binomial Method... 70.3%
[binomial] Running Binomial Method... 70.4%
[binomial] Running Binomial Method... 70.5%
[binomial] Running Binomial Method... 70.5%
[binomial] Running Binomial Method... 70.6%
[binomial] Running Binomial Method... 70.7%
[binomial] Running Binomial Method... 70.8%
[binomial] Running Binomial Method... 70.9%
[binomial] Running Binomial Method... 71.0%
[binomial] Running Binomial Method... 71.1%
[binomial] Running Binomial Method... 71.2%
[binomial] Running Binomial Method... 71.3%
[binomial] Running Binomial Method... 71.4%
[binomial] Running Binomial Method... 71.5%
[binomial] Running Binomial Method... 71.5%
[binomial] Running Binomial Method... 71.6%
[binomial] Running Binomial Method... 71.7%
[binomial] Running Binomial Method... 71.8%
[binomial] Running Binomial Method... 71.9%
[binomial] Running Binomial Method... 72.0%
[binomial] Running Binomial Method... 72.1%
[binomial] Running Binomial Method... 72.2%
[binomial] Running Binomial Method... 72.3%
[binomial] Running Binomial Method... 72.4%
[binomial] Running Binomial Method... 72.5%
[binomial] Running Binomial Method... 72.5%
[binomial] Running Binomial Method... 72.6%
[binomial] Running Binomial Method... 72.7%
[binomial] Running Binomial Method... 72.8%
[binomial] Running Binomial Method... 72.9%
[binomial] Running Binomial Method... 73.0%
[binomial] Running Binomial Method... 73.1%
[binomial] Running Binomial Method... 73.2%
[binomial] Running Binomial Method... 73.3%
[binomial] Running Binomial Method... 73.4%
[binomial] Running Binomial Method... 73.5%
[binomial] Running Binomial Method... 73.5%
[binomial] Running Binomial Method... 73.6%
[binomial] Running Binomial Method... 73.7%
[binomial] Running Binomial Method... 73.8%
[binomial] Running Binomial Method... 73.9%
[binomial] Running Binomial Method... 74.0%
[binomial] Running Binomial Method... 74.1%
[binomial] Running Binomial Method... 74.2%
[binomial] Running Binomial Method... 74.3%
[binomial] Running Binomial Method... 74.4%
[binomial] Running Binomial Method... 74.5%
[binomial] Running Binomial Method... 74.5%
[binomial] Running Binomial Method... 74.6%
[binomial] Running Binomial Method... 74.7%
[binomial] Running Binomial Method... 74.8%
[binomial] Running Binomial Method... 74.9%
[binomial] Running Binomial Method... 75.0%
[binomial] Running Binomial Method... 75.1%
[binomial] Running Binomial Method... 75.2%
[binomial] Running Binomial Method... 75.3%
[binomial] Running Binomial Method... 75.4%
[binomial] Running Binomial Method... 75.5%
[binomial] Running Binomial Method... 75.5%
[binomial] Running Binomial Method... 75.6%
[binomial] Running Binomial Method... 75.7%
[binomial] Running Binomial Method... 75.8%
[binomial] Running Binomial Method... 75.9%
[binomial] Running Binomial Method... 76.0%
[binomial] Running Binomial Method... 76.1%
[binomial] Running Binomial Method... 76.2%
[binomial] Running Binomial Method... 76.3%
[binomial] Running Binomial Method... 76.4%
[binomial] Running Binomial Method... 76.5%
[binomial] Running Binomial Method... 76.5%
[binomial] Running Binomial Method... 76.6%
[binomial] Running Binomial Method... 76.7%
[binomial] Running Binomial Method... 76.8%
[binomial] Running Binomial Method... 76.9%
[binomial] Running Binomial Method... 77.0%
[binomial] Running Binomial Method... 77.1%
[binomial] Running Binomial Method... 77.2%
[binomial] Running Binomial Method... 77.3%
[binomial] Running Binomial Method... 77.4%
[binomial] Running Binomial Method... 77.5%
[binomial] Running Binomial Method... 77.5%
[binomial] Running Binomial Method... 77.6%
[binomial] Running Binomial Method... 77.7%
[binomial] Running Binomial Method... 77.8%
[binomial] Running Binomial Method... 77.9%
[binomial] Running Binomial Method... 78.0%
[binomial] Running Binomial Method... 78.1%
[binomial] Running Binomial Method... 78.2%
[binomial] Running Binomial Method... 78.3%
[binomial] Running Binomial Method... 78.4%
[binomial] Running Binomial Method... 78.5%
[binomial] Running Binomial Method... 78.5%
[binomial] Running Binomial Method... 78.6%
[binomial] Running Binomial Method... 78.7%
[binomial] Running Binomial Method... 78.8%
[binomial] Running Binomial Method... 78.9%
[binomial] Running Binomial Method... 79.0%
[binomial] Running Binomial Method... 79.1%
[binomial] Running Binomial Method... 79.2%
[binomial] Running Binomial Method... 79.3%
[binomial] Running Binomial Method... 79.4%
[binomial] Running Binomial Method... 79.5%
[binomial] Running Binomial Method... 79.5%
[binomial] Running Binomial Method... 79.6%
[binomial] Running Binomial Method... 79.7%
[binomial] Running Binomial Method... 79.8%
[binomial] Running Binomial Method... 79.9%
[binomial] Running Binomial Method... 80.0%
[binomial] Running Binomial Method... 80.1%
[binomial] Running Binomial Method... 80.2%
[binomial] Running Binomial Method... 80.3%
[binomial] Running Binomial Method... 80.4%
[binomial] Running Binomial Method... 80.5%
[binomial] Running Binomial Method... 80.5%
[binomial] Running Binomial Method... 80.6%
[binomial] Running Binomial Method... 80.7%
[binomial] Running Binomial Method... 80.8%
[binomial] Running Binomial Method... 80.9%
[binomial] Running Binomial Method... 81.0%
[binomial] Running Binomial Method... 81.1%
[binomial] Running Binomial Method... 81.2%
[binomial] Running Binomial Method... 81.3%
[binomial] Running Binomial Method... 81.4%
[binomial] Running Binomial Method... 81.5%
[binomial] Running Binomial Method... 81.5%
[binomial] Running Binomial Method... 81.6%
[binomial] Running Binomial Method... 81.7%
[binomial] Running Binomial Method... 81.8%
[binomial] Running Binomial Method... 81.9%
[binomial] Running Binomial Method... 82.0%
[binomial] Running Binomial Method... 82.1%
[binomial] Running Binomial Method... 82.2%
[binomial] Running Binomial Method... 82.3%
[binomial] Running Binomial Method... 82.4%
[binomial] Running Binomial Method... 82.5%
[binomial] Running Binomial Method... 82.5%
[binomial] Running Binomial Method... 82.6%
[binomial] Running Binomial Method... 82.7%
[binomial] Running Binomial Method... 82.8%
[binomial] Running Binomial Method... 82.9%
[binomial] Running Binomial Method... 83.0%
[binomial] Running Binomial Method... 83.1%
[binomial] Running Binomial Method... 83.2%
[binomial] Running Binomial Method... 83.3%
[binomial] Running Binomial Method... 83.4%
[binomial] Running Binomial Method... 83.5%
[binomial] Running Binomial Method... 83.5%
[binomial] Running Binomial Method... 83.6%
[binomial] Running Binomial Method... 83.7%
[binomial] Running Binomial Method... 83.8%
[binomial] Running Binomial Method... 83.9%
[binomial] Running Binomial Method... 84.0%
[binomial] Running Binomial Method... 84.1%
[binomial] Running Binomial Method... 84.2%
[binomial] Running Binomial Method... 84.3%
[binomial] Running Binomial Method... 84.4%
[binomial] Running Binomial Method... 84.5%
[binomial] Running Binomial Method... 84.5%
[binomial] Running Binomial Method... 84.6%
[binomial] Running Binomial Method... 84.7%
[binomial] Running Binomial Method... 84.8%
[binomial] Running Binomial Method... 84.9%
[binomial] Running Binomial Method... 85.0%
[binomial] Running Binomial Method... 85.1%
[binomial] Running Binomial Method... 85.2%
[binomial] Running Binomial Method... 85.3%
[binomial] Running Binomial Method... 85.4%
[binomial] Running Binomial Method... 85.5%
[binomial] Running Binomial Method... 85.5%
[binomial] Running Binomial Method... 85.6%
[binomial] Running Binomial Method... 85.7%
[binomial] Running Binomial Method... 85.8%
[binomial] Running Binomial Method... 85.9%
[binomial] Running Binomial Method... 86.0%
[binomial] Running Binomial Method... 86.1%
[binomial] Running Binomial Method... 86.2%
[binomial] Running Binomial Method... 86.3%
[binomial] Running Binomial Method... 86.4%
[binomial] Running Binomial Method... 86.5%
[binomial] Running Binomial Method... 86.5%
[binomial] Running Binomial Method... 86.6%
[binomial] Running Binomial Method... 86.7%
[binomial] Running Binomial Method... 86.8%
[binomial] Running Binomial Method... 86.9%
[binomial] Running Binomial Method... 87.0%
[binomial] Running Binomial Method... 87.1%
[binomial] Running Binomial Method... 87.2%
[binomial] Running Binomial Method... 87.3%
[binomial] Running Binomial Method... 87.4%
[binomial] Running Binomial Method... 87.5%
[binomial] Running Binomial Method... 87.5%
[binomial] Running Binomial Method... 87.6%
[binomial] Running Binomial Method... 87.7%
[binomial] Running Binomial Method... 87.8%
[binomial] Running Binomial Method... 87.9%
[binomial] Running Binomial Method... 88.0%
[binomial] Running Binomial Method... 88.1%
[binomial] Running Binomial Method... 88.2%
[binomial] Running Binomial Method... 88.3%
[binomial] Running Binomial Method... 88.4%
[binomial] Running Binomial Method... 88.5%
[binomial] Running Binomial Method... 88.5%
[binomial] Running Binomial Method... 88.6%
[binomial] Running Binomial Method... 88.7%
[binomial] Running Binomial Method... 88.8%
[binomial] Running Binomial Method... 88.9%
[binomial] Running Binomial Method... 89.0%
[binomial] Running Binomial Method... 89.1%
[binomial] Running Binomial Method... 89.2%
[binomial] Running Binomial Method... 89.3%
[binomial] Running Binomial Method... 89.4%
[binomial] Running Binomial Method... 89.5%
[binomial] Running Binomial Method... 89.5%
[binomial] Running Binomial Method... 89.6%
[binomial] Running Binomial Method... 89.7%
[binomial] Running Binomial Method... 89.8%
[binomial] Running Binomial Method... 89.9%
[binomial] Running Binomial Method... 90.0%
[binomial] Running Binomial Method... 90.1%
[binomial] Running Binomial Method... 90.2%
[binomial] Running Binomial Method... 90.3%
[binomial] Running Binomial Method... 90.4%
[binomial] Running Binomial Method... 90.5%
[binomial] Running Binomial Method... 90.5%
[binomial] Running Binomial Method... 90.6%
[binomial] Running Binomial Method... 90.7%
[binomial] Running Binomial Method... 90.8%
[binomial] Running Binomial Method... 90.9%
[binomial] Running Binomial Method... 91.0%
[binomial] Running Binomial Method... 91.1%
[binomial] Running Binomial Method... 91.2%
[binomial] Running Binomial Method... 91.3%
[binomial] Running Binomial Method... 91.4%
[binomial] Running Binomial Method... 91.5%
[binomial] Running Binomial Method... 91.5%
[binomial] Running Binomial Method... 91.6%
[binomial] Running Binomial Method... 91.7%
[binomial] Running Binomial Method... 91.8%
[binomial] Running Binomial Method... 91.9%
[binomial] Running Binomial Method... 92.0%
[binomial] Running Binomial Method... 92.1%
[binomial] Running Binomial Method... 92.2%
[binomial] Running Binomial Method... 92.3%
[binomial] Running Binomial Method... 92.4%
[binomial] Running Binomial Method... 92.5%
[binomial] Running Binomial Method... 92.5%
[binomial] Running Binomial Method... 92.6%
[binomial] Running Binomial Method... 92.7%
[binomial] Running Binomial Method... 92.8%
[binomial] Running Binomial Method... 92.9%
[binomial] Running Binomial Method... 93.0%
[binomial] Running Binomial Method... 93.1%
[binomial] Running Binomial Method... 93.2%
[binomial] Running Binomial Method... 93.3%
[binomial] Running Binomial Method... 93.4%
[binomial] Running Binomial Method... 93.5%
[binomial] Running Binomial Method... 93.5%
[binomial] Running Binomial Method... 93.6%
[binomial] Running Binomial Method... 93.7%
[binomial] Running Binomial Method... 93.8%
[binomial] Running Binomial Method... 93.9%
[binomial] Running Binomial Method... 94.0%
[binomial] Running Binomial Method... 94.1%
[binomial] Running Binomial Method... 94.2%
[binomial] Running Binomial Method... 94.3%
[binomial] Running Binomial Method... 94.4%
[binomial] Running Binomial Method... 94.5%
[binomial] Running Binomial Method... 94.5%
[binomial] Running Binomial Method... 94.6%
[binomial] Running Binomial Method... 94.7%
[binomial] Running Binomial Method... 94.8%
[binomial] Running Binomial Method... 94.9%
[binomial] Running Binomial Method... 95.0%
[binomial] Running Binomial Method... 95.1%
[binomial] Running Binomial Method... 95.2%
[binomial] Running Binomial Method... 95.3%
[binomial] Running Binomial Method... 95.4%
[binomial] Running Binomial Method... 95.5%
[binomial] Running Binomial Method... 95.5%
[binomial] Running Binomial Method... 95.6%
[binomial] Running Binomial Method... 95.7%
[binomial] Running Binomial Method... 95.8%
[binomial] Running Binomial Method... 95.9%
[binomial] Running Binomial Method... 96.0%
[binomial] Running Binomial Method... 96.1%
[binomial] Running Binomial Method... 96.2%
[binomial] Running Binomial Method... 96.3%
[binomial] Running Binomial Method... 96.4%
[binomial] Running Binomial Method... 96.5%
[binomial] Running Binomial Method... 96.5%
[binomial] Running Binomial Method... 96.6%
[binomial] Running Binomial Method... 96.7%
[binomial] Running Binomial Method... 96.8%
[binomial] Running Binomial Method... 96.9%
[binomial] Running Binomial Method... 97.0%
[binomial] Running Binomial Method... 97.1%
[binomial] Running Binomial Method... 97.2%
[binomial] Running Binomial Method... 97.3%
[binomial] Running Binomial Method... 97.4%
[binomial] Running Binomial Method... 97.5%
[binomial] Running Binomial Method... 97.5%
[binomial] Running Binomial Method... 97.6%
[binomial] Running Binomial Method... 97.7%
[binomial] Running Binomial Method... 97.8%
[binomial] Running Binomial Method... 97.9%
[binomial] Running Binomial Method... 98.0%
[binomial] Running Binomial Method... 98.1%
[binomial] Running Binomial Method... 98.2%
[binomial] Running Binomial Method... 98.3%
[binomial] Running Binomial Method... 98.4%
[binomial] Running Binomial Method... 98.5%
[binomial] Running Binomial Method... 98.5%
[binomial] Running Binomial Method... 98.6%
[binomial] Running Binomial Method... 98.7%
[binomial] Running Binomial Method... 98.8%
[binomial] Running Binomial Method... 98.9%
[binomial] Running Binomial Method... 99.0%
[binomial] Running Binomial Method... 99.1%
[binomial] Running Binomial Method... 99.2%
[binomial] Running Binomial Method... 99.3%
[binomial] Running Binomial Method... 99.4%
[binomial] Running Binomial Method... 99.5%
[binomial] Running Binomial Method... 99.5%
[binomial] Running Binomial Method... 99.6%
[binomial] Running Binomial Method... 99.7%
[binomial] Running Binomial Method... 99.8%
[binomial] Running Binomial Method... 99.9%
[binomial] Running Binomial Method... 100.0%
ok
test_GI (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[binomial]
[binomial] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[binomial] Finished Binomial Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_GI
####################
[gi] Starting Genetic Interactions Method
[gi] Getting Data
[gi] Normalizing using: TTR
[gi] Running GI Method... 2%
[gi] Running Export Method... 0.0%
[gi] Running GI Method... 4%
[gi] Running Export Method... 2.0%
[gi] Running GI Method... 6%
[gi] Running Export Method... 4.0%
[gi] Running GI Method... 8%
[gi] Running Export Method... 6.0%
[gi] Running GI Method... 10%
[gi] Running Export Method... 8.0%
[gi] Running GI Method... 12%
[gi] Running Export Method... 10.0%
[gi] Running GI Method... 14%
[gi] Running Export Method... 12.0%
[gi] Running GI Method... 16%
[gi] Running Export Method... 14.0%
[gi] Running GI Method... 18%
[gi] Running Export Method... 16.0%
[gi] Running GI Method... 20%
[gi] Running Export Method... 18.0%
[gi] Running GI Method... 22%
[gi] Running Export Method... 20.0%
[gi] Running GI Method... 24%
[gi] Running Export Method... 22.0%
[gi] Running GI Method... 25%
[gi] Running Export Method... 24.0%
[gi] Running GI Method... 27%
[gi] Running Export Method... 26.0%
[gi] Running GI Method... 29%
[gi] Running Export Method... 28.0%
[gi] Running GI Method... 31%
[gi] Running Export Method... 30.0%
[gi] Running GI Method... 33%
[gi] Running Export Method... 32.0%
[gi] Running GI Method... 35%
[gi] Running Export Method... 34.0%
[gi] Running GI Method... 37%
[gi] Running Export Method... 36.0%
[gi] Running GI Method... 39%
[gi] Running Export Method... 38.0%
[gi] Running GI Method... 41%
[gi] Running Export Method... 40.0%
[gi] Running GI Method... 43%
[gi] Running Export Method... 42.0%
[gi] Running GI Method... 45%
[gi] Running Export Method... 44.0%
[gi] Running GI Method... 47%
[gi] Running Export Method... 46.0%
[gi] Running GI Method... 49%
[gi] Running Export Method... 48.0%
[gi] Running GI Method... 51%
[gi] Running Export Method... 50.0%
[gi] Running GI Method... 53%
[gi] Running Export Method... 52.0%
[gi] Running GI Method... 55%
[gi] Running Export Method... 54.0%
[gi] Running GI Method... 57%
[gi] Running Export Method... 56.0%
[gi] Running GI Method... 59%
[gi] Running Export Method... 58.0%
[gi] Running GI Method... 61%
[gi] Running Export Method... 60.0%
[gi] Running GI Method... 63%
[gi] Running Export Method... 62.0%
[gi] Running GI Method... 65%
[gi] Running Export Method... 64.0%
[gi] Running GI Method... 67%
[gi] Running Export Method... 66.0%
[gi] Running GI Method... 69%
[gi] Running Export Method... 68.0%
[gi] Running GI Method... 71%
[gi] Running Export Method... 70.0%
[gi] Running GI Method... 73%
[gi] Running Export Method... 72.0%
[gi] Running GI Method... 75%
[gi] Running Export Method... 74.0%
[gi] Running GI Method... 76%
[gi] Running Export Method... 76.0%
[gi] Running GI Method... 78%
[gi] Running Export Method... 78.0%
[gi] Running GI Method... 80%
[gi] Running Export Method... 80.0%
[gi] Running GI Method... 82%
[gi] Running Export Method... 82.0%
[gi] Running GI Method... 84%
[gi] Running Export Method... 84.0%
[gi] Running GI Method... 86%
[gi] Running Export Method... 86.0%
[gi] Running GI Method... 88%
[gi] Running Export Method... 88.0%
[gi] Running GI Method... 90%
[gi] Running Export Method... 90.0%
[gi] Running GI Method... 92%
[gi] Running Export Method... 92.0%
[gi] Running GI Method... 94%
[gi] Running Export Method... 94.0%
[gi] Running GI Method... 96%
[gi] Running Export Method... 96.0%
[gi] Running GI Method... 98%
[gi] Running Export Method... 98.0%
[gi] Running GI Method... 100%
[gi] Running Export Method... 100.0%
/usr/lib/python3.9/unittest/case.py:550: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='w' encoding='UTF-8'>
method()
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_Griffin (tests.test_analysis_methods.TestMethods) ... [gi] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[gi] Finished Genetic Interactions Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_Griffin
####################
[griffin] Starting Griffin Method
[griffin] Getting Data
[griffin] Running Griffin Method... 2.0%
[griffin] Running Griffin Method... 3.9%
[griffin] Running Griffin Method... 5.9%
[griffin] Running Griffin Method... 7.8%
[griffin] Running Griffin Method... 9.8%
[griffin] Running Griffin Method... 11.8%
[griffin] Running Griffin Method... 13.7%
[griffin] Running Griffin Method... 15.7%
[griffin] Running Griffin Method... 17.6%
[griffin] Running Griffin Method... 19.6%
[griffin] Running Griffin Method... 21.6%
[griffin] Running Griffin Method... 23.5%
[griffin] Running Griffin Method... 25.5%
[griffin] Running Griffin Method... 27.5%
[griffin] Running Griffin Method... 29.4%
[griffin] Running Griffin Method... 31.4%
[griffin] Running Griffin Method... 33.3%
[griffin] Running Griffin Method... 35.3%
[griffin] Running Griffin Method... 37.3%
[griffin] Running Griffin Method... 39.2%
[griffin] Running Griffin Method... 41.2%
[griffin] Running Griffin Method... 43.1%
[griffin] Running Griffin Method... 45.1%
[griffin] Running Griffin Method... 47.1%
[griffin] Running Griffin Method... 49.0%
[griffin] Running Griffin Method... 51.0%
[griffin] Running Griffin Method... 52.9%
[griffin] Running Griffin Method... 54.9%
[griffin] Running Griffin Method... 56.9%
[griffin] Running Griffin Method... 58.8%
[griffin] Running Griffin Method... 60.8%
[griffin] Running Griffin Method... 62.7%
[griffin] Running Griffin Method... 64.7%
[griffin] Running Griffin Method... 66.7%
[griffin] Running Griffin Method... 68.6%
[griffin] Running Griffin Method... 70.6%
[griffin] Running Griffin Method... 72.5%
[griffin] Running Griffin Method... 74.5%
[griffin] Running Griffin Method... 76.5%
[griffin] Running Griffin Method... 78.4%
[griffin] Running Griffin Method... 80.4%
[griffin] Running Griffin Method... 82.4%
[griffin] Running Griffin Method... 84.3%
[griffin] Running Griffin Method... 86.3%
[griffin] Running Griffin Method... 88.2%
[griffin] Running Griffin Method... 90.2%
[griffin] Running Griffin Method... 92.2%
[griffin] Running Griffin Method... 94.1%
[griffin] Running Griffin Method... 96.1%
[griffin] Running Griffin Method... 98.0%
[griffin] Running Griffin Method... 100.0%
ok
test_Gumbel (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/gumbel.py:498: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead
pval = 1 - scipy.exp(scipy.stats.gumbel_r.logcdf(r,u,B))
/<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/gumbel.py:522: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead
h0 = ((scipy.exp(scipy.stats.gumbel_r.logpdf(R,mu,sigma))) * scipy.stats.norm.pdf(S, mu_s*R, sigma_s) * (1-w1))
[griffin]
[griffin] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[griffin] Finished Griffin Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_Gumbel
####################
[gumbel] Reading Annotation
[gumbel] Getting Data
[gumbel] Doing Regression
[gumbel] Setting Initial Class
[gumbel] Running Gumbel Method... 0.2%
[gumbel] Running Gumbel Method... 0.3%
[gumbel] Running Gumbel Method... 0.4%
[gumbel] Running Gumbel Method... 0.5%
[gumbel] Running Gumbel Method... 0.5%
[gumbel] Running Gumbel Method... 0.6%
[gumbel] Running Gumbel Method... 0.7%
[gumbel] Running Gumbel Method... 0.8%
[gumbel] Running Gumbel Method... 0.9%
[gumbel] Running Gumbel Method... 1.0%
[gumbel] Running Gumbel Method... 1.1%
[gumbel] Running Gumbel Method... 1.2%
[gumbel] Running Gumbel Method... 1.3%
[gumbel] Running Gumbel Method... 1.4%
[gumbel] Running Gumbel Method... 1.5%
[gumbel] Running Gumbel Method... 1.5%
[gumbel] Running Gumbel Method... 1.6%
[gumbel] Running Gumbel Method... 1.7%
[gumbel] Running Gumbel Method... 1.8%
[gumbel] Running Gumbel Method... 1.9%
[gumbel] Running Gumbel Method... 2.0%
[gumbel] Running Gumbel Method... 2.1%
[gumbel] Running Gumbel Method... 2.2%
[gumbel] Running Gumbel Method... 2.3%
[gumbel] Running Gumbel Method... 2.4%
[gumbel] Running Gumbel Method... 2.5%
[gumbel] Running Gumbel Method... 2.5%
[gumbel] Running Gumbel Method... 2.6%
[gumbel] Running Gumbel Method... 2.7%
[gumbel] Running Gumbel Method... 2.8%
[gumbel] Running Gumbel Method... 2.9%
[gumbel] Running Gumbel Method... 3.0%
[gumbel] Running Gumbel Method... 3.1%
[gumbel] Running Gumbel Method... 3.2%
[gumbel] Running Gumbel Method... 3.3%
[gumbel] Running Gumbel Method... 3.4%
[gumbel] Running Gumbel Method... 3.5%
[gumbel] Running Gumbel Method... 3.5%
[gumbel] Running Gumbel Method... 3.6%
[gumbel] Running Gumbel Method... 3.7%
[gumbel] Running Gumbel Method... 3.8%
[gumbel] Running Gumbel Method... 3.9%
[gumbel] Running Gumbel Method... 4.0%
[gumbel] Running Gumbel Method... 4.1%
[gumbel] Running Gumbel Method... 4.2%
[gumbel] Running Gumbel Method... 4.3%
[gumbel] Running Gumbel Method... 4.4%
[gumbel] Running Gumbel Method... 4.5%
[gumbel] Running Gumbel Method... 4.5%
[gumbel] Running Gumbel Method... 4.6%
[gumbel] Running Gumbel Method... 4.7%
[gumbel] Running Gumbel Method... 4.8%
[gumbel] Running Gumbel Method... 4.9%
[gumbel] Running Gumbel Method... 5.0%
[gumbel] Running Gumbel Method... 5.1%
[gumbel] Running Gumbel Method... 5.2%
[gumbel] Running Gumbel Method... 5.3%
[gumbel] Running Gumbel Method... 5.4%
[gumbel] Running Gumbel Method... 5.5%
[gumbel] Running Gumbel Method... 5.5%
[gumbel] Running Gumbel Method... 5.6%
[gumbel] Running Gumbel Method... 5.7%
[gumbel] Running Gumbel Method... 5.8%
[gumbel] Running Gumbel Method... 5.9%
[gumbel] Running Gumbel Method... 6.0%
[gumbel] Running Gumbel Method... 6.1%
[gumbel] Running Gumbel Method... 6.2%
[gumbel] Running Gumbel Method... 6.3%
[gumbel] Running Gumbel Method... 6.4%
[gumbel] Running Gumbel Method... 6.5%
[gumbel] Running Gumbel Method... 6.5%
[gumbel] Running Gumbel Method... 6.6%
[gumbel] Running Gumbel Method... 6.7%
[gumbel] Running Gumbel Method... 6.8%
[gumbel] Running Gumbel Method... 6.9%
[gumbel] Running Gumbel Method... 7.0%
[gumbel] Running Gumbel Method... 7.1%
[gumbel] Running Gumbel Method... 7.2%
[gumbel] Running Gumbel Method... 7.3%
[gumbel] Running Gumbel Method... 7.4%
[gumbel] Running Gumbel Method... 7.5%
[gumbel] Running Gumbel Method... 7.5%
[gumbel] Running Gumbel Method... 7.6%
[gumbel] Running Gumbel Method... 7.7%
[gumbel] Running Gumbel Method... 7.8%
[gumbel] Running Gumbel Method... 7.9%
[gumbel] Running Gumbel Method... 8.0%
[gumbel] Running Gumbel Method... 8.1%
[gumbel] Running Gumbel Method... 8.2%
[gumbel] Running Gumbel Method... 8.3%
[gumbel] Running Gumbel Method... 8.4%
[gumbel] Running Gumbel Method... 8.5%
[gumbel] Running Gumbel Method... 8.5%
[gumbel] Running Gumbel Method... 8.6%
[gumbel] Running Gumbel Method... 8.7%
[gumbel] Running Gumbel Method... 8.8%
[gumbel] Running Gumbel Method... 8.9%
[gumbel] Running Gumbel Method... 9.0%
[gumbel] Running Gumbel Method... 9.1%
[gumbel] Running Gumbel Method... 9.2%
[gumbel] Running Gumbel Method... 9.3%
[gumbel] Running Gumbel Method... 9.4%
[gumbel] Running Gumbel Method... 9.5%
[gumbel] Running Gumbel Method... 9.5%
[gumbel] Running Gumbel Method... 9.6%
[gumbel] Running Gumbel Method... 9.7%
[gumbel] Running Gumbel Method... 9.8%
[gumbel] Running Gumbel Method... 9.9%
[gumbel] Running Gumbel Method... 10.0%
[gumbel] Running Gumbel Method... 10.1%
[gumbel] Running Gumbel Method... 10.2%
[gumbel] Running Gumbel Method... 10.3%
[gumbel] Running Gumbel Method... 10.4%
[gumbel] Running Gumbel Method... 10.5%
[gumbel] Running Gumbel Method... 10.5%
[gumbel] Running Gumbel Method... 10.6%
[gumbel] Running Gumbel Method... 10.7%
[gumbel] Running Gumbel Method... 10.8%
[gumbel] Running Gumbel Method... 10.9%
[gumbel] Running Gumbel Method... 11.0%
[gumbel] Running Gumbel Method... 11.1%
[gumbel] Running Gumbel Method... 11.2%
[gumbel] Running Gumbel Method... 11.3%
[gumbel] Running Gumbel Method... 11.4%
[gumbel] Running Gumbel Method... 11.5%
[gumbel] Running Gumbel Method... 11.5%
[gumbel] Running Gumbel Method... 11.6%
[gumbel] Running Gumbel Method... 11.7%
[gumbel] Running Gumbel Method... 11.8%
[gumbel] Running Gumbel Method... 11.9%
[gumbel] Running Gumbel Method... 12.0%
[gumbel] Running Gumbel Method... 12.1%
[gumbel] Running Gumbel Method... 12.2%
[gumbel] Running Gumbel Method... 12.3%
[gumbel] Running Gumbel Method... 12.4%
[gumbel] Running Gumbel Method... 12.5%
[gumbel] Running Gumbel Method... 12.5%
[gumbel] Running Gumbel Method... 12.6%
[gumbel] Running Gumbel Method... 12.7%
[gumbel] Running Gumbel Method... 12.8%
[gumbel] Running Gumbel Method... 12.9%
[gumbel] Running Gumbel Method... 13.0%
[gumbel] Running Gumbel Method... 13.1%
[gumbel] Running Gumbel Method... 13.2%
[gumbel] Running Gumbel Method... 13.3%
[gumbel] Running Gumbel Method... 13.4%
[gumbel] Running Gumbel Method... 13.5%
[gumbel] Running Gumbel Method... 13.5%
[gumbel] Running Gumbel Method... 13.6%
[gumbel] Running Gumbel Method... 13.7%
[gumbel] Running Gumbel Method... 13.8%
[gumbel] Running Gumbel Method... 13.9%
[gumbel] Running Gumbel Method... 14.0%
[gumbel] Running Gumbel Method... 14.1%
[gumbel] Running Gumbel Method... 14.2%
[gumbel] Running Gumbel Method... 14.3%
[gumbel] Running Gumbel Method... 14.4%
[gumbel] Running Gumbel Method... 14.5%
[gumbel] Running Gumbel Method... 14.5%
[gumbel] Running Gumbel Method... 14.6%
[gumbel] Running Gumbel Method... 14.7%
[gumbel] Running Gumbel Method... 14.8%
[gumbel] Running Gumbel Method... 14.9%
[gumbel] Running Gumbel Method... 15.0%
[gumbel] Running Gumbel Method... 15.1%
[gumbel] Running Gumbel Method... 15.2%
[gumbel] Running Gumbel Method... 15.3%
[gumbel] Running Gumbel Method... 15.4%
[gumbel] Running Gumbel Method... 15.5%
[gumbel] Running Gumbel Method... 15.5%
[gumbel] Running Gumbel Method... 15.6%
[gumbel] Running Gumbel Method... 15.7%
[gumbel] Running Gumbel Method... 15.8%
[gumbel] Running Gumbel Method... 15.9%
[gumbel] Running Gumbel Method... 16.0%
[gumbel] Running Gumbel Method... 16.1%
[gumbel] Running Gumbel Method... 16.2%
[gumbel] Running Gumbel Method... 16.3%
[gumbel] Running Gumbel Method... 16.4%
[gumbel] Running Gumbel Method... 16.5%
[gumbel] Running Gumbel Method... 16.5%
[gumbel] Running Gumbel Method... 16.6%
[gumbel] Running Gumbel Method... 16.7%
[gumbel] Running Gumbel Method... 16.8%
[gumbel] Running Gumbel Method... 16.9%
[gumbel] Running Gumbel Method... 17.0%
[gumbel] Running Gumbel Method... 17.1%
[gumbel] Running Gumbel Method... 17.2%
[gumbel] Running Gumbel Method... 17.3%
[gumbel] Running Gumbel Method... 17.4%
[gumbel] Running Gumbel Method... 17.5%
[gumbel] Running Gumbel Method... 17.5%
[gumbel] Running Gumbel Method... 17.6%
[gumbel] Running Gumbel Method... 17.7%
[gumbel] Running Gumbel Method... 17.8%
[gumbel] Running Gumbel Method... 17.9%
[gumbel] Running Gumbel Method... 18.0%
[gumbel] Running Gumbel Method... 18.1%
[gumbel] Running Gumbel Method... 18.2%
[gumbel] Running Gumbel Method... 18.3%
[gumbel] Running Gumbel Method... 18.4%
[gumbel] Running Gumbel Method... 18.5%
[gumbel] Running Gumbel Method... 18.5%
[gumbel] Running Gumbel Method... 18.6%
[gumbel] Running Gumbel Method... 18.7%
[gumbel] Running Gumbel Method... 18.8%
[gumbel] Running Gumbel Method... 18.9%
[gumbel] Running Gumbel Method... 19.0%
[gumbel] Running Gumbel Method... 19.1%
[gumbel] Running Gumbel Method... 19.2%
[gumbel] Running Gumbel Method... 19.3%
[gumbel] Running Gumbel Method... 19.4%
[gumbel] Running Gumbel Method... 19.5%
[gumbel] Running Gumbel Method... 19.5%
[gumbel] Running Gumbel Method... 19.6%
[gumbel] Running Gumbel Method... 19.7%
[gumbel] Running Gumbel Method... 19.8%
[gumbel] Running Gumbel Method... 19.9%
[gumbel] Running Gumbel Method... 20.0%
[gumbel] Running Gumbel Method... 20.1%
[gumbel] Running Gumbel Method... 20.2%
[gumbel] Running Gumbel Method... 20.3%
[gumbel] Running Gumbel Method... 20.4%
[gumbel] Running Gumbel Method... 20.5%
[gumbel] Running Gumbel Method... 20.5%
[gumbel] Running Gumbel Method... 20.6%
[gumbel] Running Gumbel Method... 20.7%
[gumbel] Running Gumbel Method... 20.8%
[gumbel] Running Gumbel Method... 20.9%
[gumbel] Running Gumbel Method... 21.0%
[gumbel] Running Gumbel Method... 21.1%
[gumbel] Running Gumbel Method... 21.2%
[gumbel] Running Gumbel Method... 21.3%
[gumbel] Running Gumbel Method... 21.4%
[gumbel] Running Gumbel Method... 21.5%
[gumbel] Running Gumbel Method... 21.5%
[gumbel] Running Gumbel Method... 21.6%
[gumbel] Running Gumbel Method... 21.7%
[gumbel] Running Gumbel Method... 21.8%
[gumbel] Running Gumbel Method... 21.9%
[gumbel] Running Gumbel Method... 22.0%
[gumbel] Running Gumbel Method... 22.1%
[gumbel] Running Gumbel Method... 22.2%
[gumbel] Running Gumbel Method... 22.3%
[gumbel] Running Gumbel Method... 22.4%
[gumbel] Running Gumbel Method... 22.5%
[gumbel] Running Gumbel Method... 22.5%
[gumbel] Running Gumbel Method... 22.6%
[gumbel] Running Gumbel Method... 22.7%
[gumbel] Running Gumbel Method... 22.8%
[gumbel] Running Gumbel Method... 22.9%
[gumbel] Running Gumbel Method... 23.0%
[gumbel] Running Gumbel Method... 23.1%
[gumbel] Running Gumbel Method... 23.2%
[gumbel] Running Gumbel Method... 23.3%
[gumbel] Running Gumbel Method... 23.4%
[gumbel] Running Gumbel Method... 23.5%
[gumbel] Running Gumbel Method... 23.5%
[gumbel] Running Gumbel Method... 23.6%
[gumbel] Running Gumbel Method... 23.7%
[gumbel] Running Gumbel Method... 23.8%
[gumbel] Running Gumbel Method... 23.9%
[gumbel] Running Gumbel Method... 24.0%
[gumbel] Running Gumbel Method... 24.1%
[gumbel] Running Gumbel Method... 24.2%
[gumbel] Running Gumbel Method... 24.3%
[gumbel] Running Gumbel Method... 24.4%
[gumbel] Running Gumbel Method... 24.5%
[gumbel] Running Gumbel Method... 24.5%
[gumbel] Running Gumbel Method... 24.6%
[gumbel] Running Gumbel Method... 24.7%
[gumbel] Running Gumbel Method... 24.8%
[gumbel] Running Gumbel Method... 24.9%
[gumbel] Running Gumbel Method... 25.0%
[gumbel] Running Gumbel Method... 25.1%
[gumbel] Running Gumbel Method... 25.2%
[gumbel] Running Gumbel Method... 25.3%
[gumbel] Running Gumbel Method... 25.4%
[gumbel] Running Gumbel Method... 25.5%
[gumbel] Running Gumbel Method... 25.5%
[gumbel] Running Gumbel Method... 25.6%
[gumbel] Running Gumbel Method... 25.7%
[gumbel] Running Gumbel Method... 25.8%
[gumbel] Running Gumbel Method... 25.9%
[gumbel] Running Gumbel Method... 26.0%
[gumbel] Running Gumbel Method... 26.1%
[gumbel] Running Gumbel Method... 26.2%
[gumbel] Running Gumbel Method... 26.3%
[gumbel] Running Gumbel Method... 26.4%
[gumbel] Running Gumbel Method... 26.5%
[gumbel] Running Gumbel Method... 26.5%
[gumbel] Running Gumbel Method... 26.6%
[gumbel] Running Gumbel Method... 26.7%
[gumbel] Running Gumbel Method... 26.8%
[gumbel] Running Gumbel Method... 26.9%
[gumbel] Running Gumbel Method... 27.0%
[gumbel] Running Gumbel Method... 27.1%
[gumbel] Running Gumbel Method... 27.2%
[gumbel] Running Gumbel Method... 27.3%
[gumbel] Running Gumbel Method... 27.4%
[gumbel] Running Gumbel Method... 27.5%
[gumbel] Running Gumbel Method... 27.5%
[gumbel] Running Gumbel Method... 27.6%
[gumbel] Running Gumbel Method... 27.7%
[gumbel] Running Gumbel Method... 27.8%
[gumbel] Running Gumbel Method... 27.9%
[gumbel] Running Gumbel Method... 28.0%
[gumbel] Running Gumbel Method... 28.1%
[gumbel] Running Gumbel Method... 28.2%
[gumbel] Running Gumbel Method... 28.3%
[gumbel] Running Gumbel Method... 28.4%
[gumbel] Running Gumbel Method... 28.5%
[gumbel] Running Gumbel Method... 28.5%
[gumbel] Running Gumbel Method... 28.6%
[gumbel] Running Gumbel Method... 28.7%
[gumbel] Running Gumbel Method... 28.8%
[gumbel] Running Gumbel Method... 28.9%
[gumbel] Running Gumbel Method... 29.0%
[gumbel] Running Gumbel Method... 29.1%
[gumbel] Running Gumbel Method... 29.2%
[gumbel] Running Gumbel Method... 29.3%
[gumbel] Running Gumbel Method... 29.4%
[gumbel] Running Gumbel Method... 29.5%
[gumbel] Running Gumbel Method... 29.5%
[gumbel] Running Gumbel Method... 29.6%
[gumbel] Running Gumbel Method... 29.7%
[gumbel] Running Gumbel Method... 29.8%
[gumbel] Running Gumbel Method... 29.9%
[gumbel] Running Gumbel Method... 30.0%
[gumbel] Running Gumbel Method... 30.1%
[gumbel] Running Gumbel Method... 30.2%
[gumbel] Running Gumbel Method... 30.3%
[gumbel] Running Gumbel Method... 30.4%
[gumbel] Running Gumbel Method... 30.5%
[gumbel] Running Gumbel Method... 30.5%
[gumbel] Running Gumbel Method... 30.6%
[gumbel] Running Gumbel Method... 30.7%
[gumbel] Running Gumbel Method... 30.8%
[gumbel] Running Gumbel Method... 30.9%
[gumbel] Running Gumbel Method... 31.0%
[gumbel] Running Gumbel Method... 31.1%
[gumbel] Running Gumbel Method... 31.2%
[gumbel] Running Gumbel Method... 31.3%
[gumbel] Running Gumbel Method... 31.4%
[gumbel] Running Gumbel Method... 31.5%
[gumbel] Running Gumbel Method... 31.5%
[gumbel] Running Gumbel Method... 31.6%
[gumbel] Running Gumbel Method... 31.7%
[gumbel] Running Gumbel Method... 31.8%
[gumbel] Running Gumbel Method... 31.9%
[gumbel] Running Gumbel Method... 32.0%
[gumbel] Running Gumbel Method... 32.1%
[gumbel] Running Gumbel Method... 32.2%
[gumbel] Running Gumbel Method... 32.3%
[gumbel] Running Gumbel Method... 32.4%
[gumbel] Running Gumbel Method... 32.5%
[gumbel] Running Gumbel Method... 32.5%
[gumbel] Running Gumbel Method... 32.6%
[gumbel] Running Gumbel Method... 32.7%
[gumbel] Running Gumbel Method... 32.8%
[gumbel] Running Gumbel Method... 32.9%
[gumbel] Running Gumbel Method... 33.0%
[gumbel] Running Gumbel Method... 33.1%
[gumbel] Running Gumbel Method... 33.2%
[gumbel] Running Gumbel Method... 33.3%
[gumbel] Running Gumbel Method... 33.4%
[gumbel] Running Gumbel Method... 33.5%
[gumbel] Running Gumbel Method... 33.5%
[gumbel] Running Gumbel Method... 33.6%
[gumbel] Running Gumbel Method... 33.7%
[gumbel] Running Gumbel Method... 33.8%
[gumbel] Running Gumbel Method... 33.9%
[gumbel] Running Gumbel Method... 34.0%
[gumbel] Running Gumbel Method... 34.1%
[gumbel] Running Gumbel Method... 34.2%
[gumbel] Running Gumbel Method... 34.3%
[gumbel] Running Gumbel Method... 34.4%
[gumbel] Running Gumbel Method... 34.5%
[gumbel] Running Gumbel Method... 34.5%
[gumbel] Running Gumbel Method... 34.6%
[gumbel] Running Gumbel Method... 34.7%
[gumbel] Running Gumbel Method... 34.8%
[gumbel] Running Gumbel Method... 34.9%
[gumbel] Running Gumbel Method... 35.0%
[gumbel] Running Gumbel Method... 35.1%
[gumbel] Running Gumbel Method... 35.2%
[gumbel] Running Gumbel Method... 35.3%
[gumbel] Running Gumbel Method... 35.4%
[gumbel] Running Gumbel Method... 35.5%
[gumbel] Running Gumbel Method... 35.5%
[gumbel] Running Gumbel Method... 35.6%
[gumbel] Running Gumbel Method... 35.7%
[gumbel] Running Gumbel Method... 35.8%
[gumbel] Running Gumbel Method... 35.9%
[gumbel] Running Gumbel Method... 36.0%
[gumbel] Running Gumbel Method... 36.1%
[gumbel] Running Gumbel Method... 36.2%
[gumbel] Running Gumbel Method... 36.3%
[gumbel] Running Gumbel Method... 36.4%
[gumbel] Running Gumbel Method... 36.5%
[gumbel] Running Gumbel Method... 36.5%
[gumbel] Running Gumbel Method... 36.6%
[gumbel] Running Gumbel Method... 36.7%
[gumbel] Running Gumbel Method... 36.8%
[gumbel] Running Gumbel Method... 36.9%
[gumbel] Running Gumbel Method... 37.0%
[gumbel] Running Gumbel Method... 37.1%
[gumbel] Running Gumbel Method... 37.2%
[gumbel] Running Gumbel Method... 37.3%
[gumbel] Running Gumbel Method... 37.4%
[gumbel] Running Gumbel Method... 37.5%
[gumbel] Running Gumbel Method... 37.5%
[gumbel] Running Gumbel Method... 37.6%
[gumbel] Running Gumbel Method... 37.7%
[gumbel] Running Gumbel Method... 37.8%
[gumbel] Running Gumbel Method... 37.9%
[gumbel] Running Gumbel Method... 38.0%
[gumbel] Running Gumbel Method... 38.1%
[gumbel] Running Gumbel Method... 38.2%
[gumbel] Running Gumbel Method... 38.3%
[gumbel] Running Gumbel Method... 38.4%
[gumbel] Running Gumbel Method... 38.5%
[gumbel] Running Gumbel Method... 38.5%
[gumbel] Running Gumbel Method... 38.6%
[gumbel] Running Gumbel Method... 38.7%
[gumbel] Running Gumbel Method... 38.8%
[gumbel] Running Gumbel Method... 38.9%
[gumbel] Running Gumbel Method... 39.0%
[gumbel] Running Gumbel Method... 39.1%
[gumbel] Running Gumbel Method... 39.2%
[gumbel] Running Gumbel Method... 39.3%
[gumbel] Running Gumbel Method... 39.4%
[gumbel] Running Gumbel Method... 39.5%
[gumbel] Running Gumbel Method... 39.5%
[gumbel] Running Gumbel Method... 39.6%
[gumbel] Running Gumbel Method... 39.7%
[gumbel] Running Gumbel Method... 39.8%
[gumbel] Running Gumbel Method... 39.9%
[gumbel] Running Gumbel Method... 40.0%
[gumbel] Running Gumbel Method... 40.1%
[gumbel] Running Gumbel Method... 40.2%
[gumbel] Running Gumbel Method... 40.3%
[gumbel] Running Gumbel Method... 40.4%
[gumbel] Running Gumbel Method... 40.5%
[gumbel] Running Gumbel Method... 40.5%
[gumbel] Running Gumbel Method... 40.6%
[gumbel] Running Gumbel Method... 40.7%
[gumbel] Running Gumbel Method... 40.8%
[gumbel] Running Gumbel Method... 40.9%
[gumbel] Running Gumbel Method... 41.0%
[gumbel] Running Gumbel Method... 41.1%
[gumbel] Running Gumbel Method... 41.2%
[gumbel] Running Gumbel Method... 41.3%
[gumbel] Running Gumbel Method... 41.4%
[gumbel] Running Gumbel Method... 41.5%
[gumbel] Running Gumbel Method... 41.5%
[gumbel] Running Gumbel Method... 41.6%
[gumbel] Running Gumbel Method... 41.7%
[gumbel] Running Gumbel Method... 41.8%
[gumbel] Running Gumbel Method... 41.9%
[gumbel] Running Gumbel Method... 42.0%
[gumbel] Running Gumbel Method... 42.1%
[gumbel] Running Gumbel Method... 42.2%
[gumbel] Running Gumbel Method... 42.3%
[gumbel] Running Gumbel Method... 42.4%
[gumbel] Running Gumbel Method... 42.5%
[gumbel] Running Gumbel Method... 42.5%
[gumbel] Running Gumbel Method... 42.6%
[gumbel] Running Gumbel Method... 42.7%
[gumbel] Running Gumbel Method... 42.8%
[gumbel] Running Gumbel Method... 42.9%
[gumbel] Running Gumbel Method... 43.0%
[gumbel] Running Gumbel Method... 43.1%
[gumbel] Running Gumbel Method... 43.2%
[gumbel] Running Gumbel Method... 43.3%
[gumbel] Running Gumbel Method... 43.4%
[gumbel] Running Gumbel Method... 43.5%
[gumbel] Running Gumbel Method... 43.5%
[gumbel] Running Gumbel Method... 43.6%
[gumbel] Running Gumbel Method... 43.7%
[gumbel] Running Gumbel Method... 43.8%
[gumbel] Running Gumbel Method... 43.9%
[gumbel] Running Gumbel Method... 44.0%
[gumbel] Running Gumbel Method... 44.1%
[gumbel] Running Gumbel Method... 44.2%
[gumbel] Running Gumbel Method... 44.3%
[gumbel] Running Gumbel Method... 44.4%
[gumbel] Running Gumbel Method... 44.5%
[gumbel] Running Gumbel Method... 44.5%
[gumbel] Running Gumbel Method... 44.6%
[gumbel] Running Gumbel Method... 44.7%
[gumbel] Running Gumbel Method... 44.8%
[gumbel] Running Gumbel Method... 44.9%
[gumbel] Running Gumbel Method... 45.0%
[gumbel] Running Gumbel Method... 45.1%
[gumbel] Running Gumbel Method... 45.2%
[gumbel] Running Gumbel Method... 45.3%
[gumbel] Running Gumbel Method... 45.4%
[gumbel] Running Gumbel Method... 45.5%
[gumbel] Running Gumbel Method... 45.5%
[gumbel] Running Gumbel Method... 45.6%
[gumbel] Running Gumbel Method... 45.7%
[gumbel] Running Gumbel Method... 45.8%
[gumbel] Running Gumbel Method... 45.9%
[gumbel] Running Gumbel Method... 46.0%
[gumbel] Running Gumbel Method... 46.1%
[gumbel] Running Gumbel Method... 46.2%
[gumbel] Running Gumbel Method... 46.3%
[gumbel] Running Gumbel Method... 46.4%
[gumbel] Running Gumbel Method... 46.5%
[gumbel] Running Gumbel Method... 46.5%
[gumbel] Running Gumbel Method... 46.6%
[gumbel] Running Gumbel Method... 46.7%
[gumbel] Running Gumbel Method... 46.8%
[gumbel] Running Gumbel Method... 46.9%
[gumbel] Running Gumbel Method... 47.0%
[gumbel] Running Gumbel Method... 47.1%
[gumbel] Running Gumbel Method... 47.2%
[gumbel] Running Gumbel Method... 47.3%
[gumbel] Running Gumbel Method... 47.4%
[gumbel] Running Gumbel Method... 47.5%
[gumbel] Running Gumbel Method... 47.5%
[gumbel] Running Gumbel Method... 47.6%
[gumbel] Running Gumbel Method... 47.7%
[gumbel] Running Gumbel Method... 47.8%
[gumbel] Running Gumbel Method... 47.9%
[gumbel] Running Gumbel Method... 48.0%
[gumbel] Running Gumbel Method... 48.1%
[gumbel] Running Gumbel Method... 48.2%
[gumbel] Running Gumbel Method... 48.3%
[gumbel] Running Gumbel Method... 48.4%
[gumbel] Running Gumbel Method... 48.5%
[gumbel] Running Gumbel Method... 48.5%
[gumbel] Running Gumbel Method... 48.6%
[gumbel] Running Gumbel Method... 48.7%
[gumbel] Running Gumbel Method... 48.8%
[gumbel] Running Gumbel Method... 48.9%
[gumbel] Running Gumbel Method... 49.0%
[gumbel] Running Gumbel Method... 49.1%
[gumbel] Running Gumbel Method... 49.2%
[gumbel] Running Gumbel Method... 49.3%
[gumbel] Running Gumbel Method... 49.4%
[gumbel] Running Gumbel Method... 49.5%
[gumbel] Running Gumbel Method... 49.5%
[gumbel] Running Gumbel Method... 49.6%
[gumbel] Running Gumbel Method... 49.7%
[gumbel] Running Gumbel Method... 49.8%
[gumbel] Running Gumbel Method... 49.9%
[gumbel] Running Gumbel Method... 50.0%
[gumbel] Running Gumbel Method... 50.1%
[gumbel] Running Gumbel Method... 50.2%
[gumbel] Running Gumbel Method... 50.3%
[gumbel] Running Gumbel Method... 50.4%
[gumbel] Running Gumbel Method... 50.5%
[gumbel] Running Gumbel Method... 50.5%
[gumbel] Running Gumbel Method... 50.6%
[gumbel] Running Gumbel Method... 50.7%
[gumbel] Running Gumbel Method... 50.8%
[gumbel] Running Gumbel Method... 50.9%
[gumbel] Running Gumbel Method... 51.0%
[gumbel] Running Gumbel Method... 51.1%
[gumbel] Running Gumbel Method... 51.2%
[gumbel] Running Gumbel Method... 51.3%
[gumbel] Running Gumbel Method... 51.4%
[gumbel] Running Gumbel Method... 51.5%
[gumbel] Running Gumbel Method... 51.5%
[gumbel] Running Gumbel Method... 51.6%
[gumbel] Running Gumbel Method... 51.7%
[gumbel] Running Gumbel Method... 51.8%
[gumbel] Running Gumbel Method... 51.9%
[gumbel] Running Gumbel Method... 52.0%
[gumbel] Running Gumbel Method... 52.1%
[gumbel] Running Gumbel Method... 52.2%
[gumbel] Running Gumbel Method... 52.3%
[gumbel] Running Gumbel Method... 52.4%
[gumbel] Running Gumbel Method... 52.5%
[gumbel] Running Gumbel Method... 52.5%
[gumbel] Running Gumbel Method... 52.6%
[gumbel] Running Gumbel Method... 52.7%
[gumbel] Running Gumbel Method... 52.8%
[gumbel] Running Gumbel Method... 52.9%
[gumbel] Running Gumbel Method... 53.0%
[gumbel] Running Gumbel Method... 53.1%
[gumbel] Running Gumbel Method... 53.2%
[gumbel] Running Gumbel Method... 53.3%
[gumbel] Running Gumbel Method... 53.4%
[gumbel] Running Gumbel Method... 53.5%
[gumbel] Running Gumbel Method... 53.5%
[gumbel] Running Gumbel Method... 53.6%
[gumbel] Running Gumbel Method... 53.7%
[gumbel] Running Gumbel Method... 53.8%
[gumbel] Running Gumbel Method... 53.9%
[gumbel] Running Gumbel Method... 54.0%
[gumbel] Running Gumbel Method... 54.1%
[gumbel] Running Gumbel Method... 54.2%
[gumbel] Running Gumbel Method... 54.3%
[gumbel] Running Gumbel Method... 54.4%
[gumbel] Running Gumbel Method... 54.5%
[gumbel] Running Gumbel Method... 54.5%
[gumbel] Running Gumbel Method... 54.6%
[gumbel] Running Gumbel Method... 54.7%
[gumbel] Running Gumbel Method... 54.8%
[gumbel] Running Gumbel Method... 54.9%
[gumbel] Running Gumbel Method... 55.0%
[gumbel] Running Gumbel Method... 55.1%
[gumbel] Running Gumbel Method... 55.2%
[gumbel] Running Gumbel Method... 55.3%
[gumbel] Running Gumbel Method... 55.4%
[gumbel] Running Gumbel Method... 55.5%
[gumbel] Running Gumbel Method... 55.5%
[gumbel] Running Gumbel Method... 55.6%
[gumbel] Running Gumbel Method... 55.7%
[gumbel] Running Gumbel Method... 55.8%
[gumbel] Running Gumbel Method... 55.9%
[gumbel] Running Gumbel Method... 56.0%
[gumbel] Running Gumbel Method... 56.1%
[gumbel] Running Gumbel Method... 56.2%
[gumbel] Running Gumbel Method... 56.3%
[gumbel] Running Gumbel Method... 56.4%
[gumbel] Running Gumbel Method... 56.5%
[gumbel] Running Gumbel Method... 56.5%
[gumbel] Running Gumbel Method... 56.6%
[gumbel] Running Gumbel Method... 56.7%
[gumbel] Running Gumbel Method... 56.8%
[gumbel] Running Gumbel Method... 56.9%
[gumbel] Running Gumbel Method... 57.0%
[gumbel] Running Gumbel Method... 57.1%
[gumbel] Running Gumbel Method... 57.2%
[gumbel] Running Gumbel Method... 57.3%
[gumbel] Running Gumbel Method... 57.4%
[gumbel] Running Gumbel Method... 57.5%
[gumbel] Running Gumbel Method... 57.5%
[gumbel] Running Gumbel Method... 57.6%
[gumbel] Running Gumbel Method... 57.7%
[gumbel] Running Gumbel Method... 57.8%
[gumbel] Running Gumbel Method... 57.9%
[gumbel] Running Gumbel Method... 58.0%
[gumbel] Running Gumbel Method... 58.1%
[gumbel] Running Gumbel Method... 58.2%
[gumbel] Running Gumbel Method... 58.3%
[gumbel] Running Gumbel Method... 58.4%
[gumbel] Running Gumbel Method... 58.5%
[gumbel] Running Gumbel Method... 58.5%
[gumbel] Running Gumbel Method... 58.6%
[gumbel] Running Gumbel Method... 58.7%
[gumbel] Running Gumbel Method... 58.8%
[gumbel] Running Gumbel Method... 58.9%
[gumbel] Running Gumbel Method... 59.0%
[gumbel] Running Gumbel Method... 59.1%
[gumbel] Running Gumbel Method... 59.2%
[gumbel] Running Gumbel Method... 59.3%
[gumbel] Running Gumbel Method... 59.4%
[gumbel] Running Gumbel Method... 59.5%
[gumbel] Running Gumbel Method... 59.5%
[gumbel] Running Gumbel Method... 59.6%
[gumbel] Running Gumbel Method... 59.7%
[gumbel] Running Gumbel Method... 59.8%
[gumbel] Running Gumbel Method... 59.9%
[gumbel] Running Gumbel Method... 60.0%
[gumbel] Running Gumbel Method... 60.1%
[gumbel] Running Gumbel Method... 60.2%
[gumbel] Running Gumbel Method... 60.3%
[gumbel] Running Gumbel Method... 60.4%
[gumbel] Running Gumbel Method... 60.5%
[gumbel] Running Gumbel Method... 60.5%
[gumbel] Running Gumbel Method... 60.6%
[gumbel] Running Gumbel Method... 60.7%
[gumbel] Running Gumbel Method... 60.8%
[gumbel] Running Gumbel Method... 60.9%
[gumbel] Running Gumbel Method... 61.0%
[gumbel] Running Gumbel Method... 61.1%
[gumbel] Running Gumbel Method... 61.2%
[gumbel] Running Gumbel Method... 61.3%
[gumbel] Running Gumbel Method... 61.4%
[gumbel] Running Gumbel Method... 61.5%
[gumbel] Running Gumbel Method... 61.5%
[gumbel] Running Gumbel Method... 61.6%
[gumbel] Running Gumbel Method... 61.7%
[gumbel] Running Gumbel Method... 61.8%
[gumbel] Running Gumbel Method... 61.9%
[gumbel] Running Gumbel Method... 62.0%
[gumbel] Running Gumbel Method... 62.1%
[gumbel] Running Gumbel Method... 62.2%
[gumbel] Running Gumbel Method... 62.3%
[gumbel] Running Gumbel Method... 62.4%
[gumbel] Running Gumbel Method... 62.5%
[gumbel] Running Gumbel Method... 62.5%
[gumbel] Running Gumbel Method... 62.6%
[gumbel] Running Gumbel Method... 62.7%
[gumbel] Running Gumbel Method... 62.8%
[gumbel] Running Gumbel Method... 62.9%
[gumbel] Running Gumbel Method... 63.0%
[gumbel] Running Gumbel Method... 63.1%
[gumbel] Running Gumbel Method... 63.2%
[gumbel] Running Gumbel Method... 63.3%
[gumbel] Running Gumbel Method... 63.4%
[gumbel] Running Gumbel Method... 63.5%
[gumbel] Running Gumbel Method... 63.5%
[gumbel] Running Gumbel Method... 63.6%
[gumbel] Running Gumbel Method... 63.7%
[gumbel] Running Gumbel Method... 63.8%
[gumbel] Running Gumbel Method... 63.9%
[gumbel] Running Gumbel Method... 64.0%
[gumbel] Running Gumbel Method... 64.1%
[gumbel] Running Gumbel Method... 64.2%
[gumbel] Running Gumbel Method... 64.3%
[gumbel] Running Gumbel Method... 64.4%
[gumbel] Running Gumbel Method... 64.5%
[gumbel] Running Gumbel Method... 64.5%
[gumbel] Running Gumbel Method... 64.6%
[gumbel] Running Gumbel Method... 64.7%
[gumbel] Running Gumbel Method... 64.8%
[gumbel] Running Gumbel Method... 64.9%
[gumbel] Running Gumbel Method... 65.0%
[gumbel] Running Gumbel Method... 65.1%
[gumbel] Running Gumbel Method... 65.2%
[gumbel] Running Gumbel Method... 65.3%
[gumbel] Running Gumbel Method... 65.4%
[gumbel] Running Gumbel Method... 65.5%
[gumbel] Running Gumbel Method... 65.5%
[gumbel] Running Gumbel Method... 65.6%
[gumbel] Running Gumbel Method... 65.7%
[gumbel] Running Gumbel Method... 65.8%
[gumbel] Running Gumbel Method... 65.9%
[gumbel] Running Gumbel Method... 66.0%
[gumbel] Running Gumbel Method... 66.1%
[gumbel] Running Gumbel Method... 66.2%
[gumbel] Running Gumbel Method... 66.3%
[gumbel] Running Gumbel Method... 66.4%
[gumbel] Running Gumbel Method... 66.5%
[gumbel] Running Gumbel Method... 66.5%
[gumbel] Running Gumbel Method... 66.6%
[gumbel] Running Gumbel Method... 66.7%
[gumbel] Running Gumbel Method... 66.8%
[gumbel] Running Gumbel Method... 66.9%
[gumbel] Running Gumbel Method... 67.0%
[gumbel] Running Gumbel Method... 67.1%
[gumbel] Running Gumbel Method... 67.2%
[gumbel] Running Gumbel Method... 67.3%
[gumbel] Running Gumbel Method... 67.4%
[gumbel] Running Gumbel Method... 67.5%
[gumbel] Running Gumbel Method... 67.5%
[gumbel] Running Gumbel Method... 67.6%
[gumbel] Running Gumbel Method... 67.7%
[gumbel] Running Gumbel Method... 67.8%
[gumbel] Running Gumbel Method... 67.9%
[gumbel] Running Gumbel Method... 68.0%
[gumbel] Running Gumbel Method... 68.1%
[gumbel] Running Gumbel Method... 68.2%
[gumbel] Running Gumbel Method... 68.3%
[gumbel] Running Gumbel Method... 68.4%
[gumbel] Running Gumbel Method... 68.5%
[gumbel] Running Gumbel Method... 68.5%
[gumbel] Running Gumbel Method... 68.6%
[gumbel] Running Gumbel Method... 68.7%
[gumbel] Running Gumbel Method... 68.8%
[gumbel] Running Gumbel Method... 68.9%
[gumbel] Running Gumbel Method... 69.0%
[gumbel] Running Gumbel Method... 69.1%
[gumbel] Running Gumbel Method... 69.2%
[gumbel] Running Gumbel Method... 69.3%
[gumbel] Running Gumbel Method... 69.4%
[gumbel] Running Gumbel Method... 69.5%
[gumbel] Running Gumbel Method... 69.5%
[gumbel] Running Gumbel Method... 69.6%
[gumbel] Running Gumbel Method... 69.7%
[gumbel] Running Gumbel Method... 69.8%
[gumbel] Running Gumbel Method... 69.9%
[gumbel] Running Gumbel Method... 70.0%
[gumbel] Running Gumbel Method... 70.1%
[gumbel] Running Gumbel Method... 70.2%
[gumbel] Running Gumbel Method... 70.3%
[gumbel] Running Gumbel Method... 70.4%
[gumbel] Running Gumbel Method... 70.5%
[gumbel] Running Gumbel Method... 70.5%
[gumbel] Running Gumbel Method... 70.6%
[gumbel] Running Gumbel Method... 70.7%
[gumbel] Running Gumbel Method... 70.8%
[gumbel] Running Gumbel Method... 70.9%
[gumbel] Running Gumbel Method... 71.0%
[gumbel] Running Gumbel Method... 71.1%
[gumbel] Running Gumbel Method... 71.2%
[gumbel] Running Gumbel Method... 71.3%
[gumbel] Running Gumbel Method... 71.4%
[gumbel] Running Gumbel Method... 71.5%
[gumbel] Running Gumbel Method... 71.5%
[gumbel] Running Gumbel Method... 71.6%
[gumbel] Running Gumbel Method... 71.7%
[gumbel] Running Gumbel Method... 71.8%
[gumbel] Running Gumbel Method... 71.9%
[gumbel] Running Gumbel Method... 72.0%
[gumbel] Running Gumbel Method... 72.1%
[gumbel] Running Gumbel Method... 72.2%
[gumbel] Running Gumbel Method... 72.3%
[gumbel] Running Gumbel Method... 72.4%
[gumbel] Running Gumbel Method... 72.5%
[gumbel] Running Gumbel Method... 72.5%
[gumbel] Running Gumbel Method... 72.6%
[gumbel] Running Gumbel Method... 72.7%
[gumbel] Running Gumbel Method... 72.8%
[gumbel] Running Gumbel Method... 72.9%
[gumbel] Running Gumbel Method... 73.0%
[gumbel] Running Gumbel Method... 73.1%
[gumbel] Running Gumbel Method... 73.2%
[gumbel] Running Gumbel Method... 73.3%
[gumbel] Running Gumbel Method... 73.4%
[gumbel] Running Gumbel Method... 73.5%
[gumbel] Running Gumbel Method... 73.5%
[gumbel] Running Gumbel Method... 73.6%
[gumbel] Running Gumbel Method... 73.7%
[gumbel] Running Gumbel Method... 73.8%
[gumbel] Running Gumbel Method... 73.9%
[gumbel] Running Gumbel Method... 74.0%
[gumbel] Running Gumbel Method... 74.1%
[gumbel] Running Gumbel Method... 74.2%
[gumbel] Running Gumbel Method... 74.3%
[gumbel] Running Gumbel Method... 74.4%
[gumbel] Running Gumbel Method... 74.5%
[gumbel] Running Gumbel Method... 74.5%
[gumbel] Running Gumbel Method... 74.6%
[gumbel] Running Gumbel Method... 74.7%
[gumbel] Running Gumbel Method... 74.8%
[gumbel] Running Gumbel Method... 74.9%
[gumbel] Running Gumbel Method... 75.0%
[gumbel] Running Gumbel Method... 75.1%
[gumbel] Running Gumbel Method... 75.2%
[gumbel] Running Gumbel Method... 75.3%
[gumbel] Running Gumbel Method... 75.4%
[gumbel] Running Gumbel Method... 75.5%
[gumbel] Running Gumbel Method... 75.5%
[gumbel] Running Gumbel Method... 75.6%
[gumbel] Running Gumbel Method... 75.7%
[gumbel] Running Gumbel Method... 75.8%
[gumbel] Running Gumbel Method... 75.9%
[gumbel] Running Gumbel Method... 76.0%
[gumbel] Running Gumbel Method... 76.1%
[gumbel] Running Gumbel Method... 76.2%
[gumbel] Running Gumbel Method... 76.3%
[gumbel] Running Gumbel Method... 76.4%
[gumbel] Running Gumbel Method... 76.5%
[gumbel] Running Gumbel Method... 76.5%
[gumbel] Running Gumbel Method... 76.6%
[gumbel] Running Gumbel Method... 76.7%
[gumbel] Running Gumbel Method... 76.8%
[gumbel] Running Gumbel Method... 76.9%
[gumbel] Running Gumbel Method... 77.0%
[gumbel] Running Gumbel Method... 77.1%
[gumbel] Running Gumbel Method... 77.2%
[gumbel] Running Gumbel Method... 77.3%
[gumbel] Running Gumbel Method... 77.4%
[gumbel] Running Gumbel Method... 77.5%
[gumbel] Running Gumbel Method... 77.5%
[gumbel] Running Gumbel Method... 77.6%
[gumbel] Running Gumbel Method... 77.7%
[gumbel] Running Gumbel Method... 77.8%
[gumbel] Running Gumbel Method... 77.9%
[gumbel] Running Gumbel Method... 78.0%
[gumbel] Running Gumbel Method... 78.1%
[gumbel] Running Gumbel Method... 78.2%
[gumbel] Running Gumbel Method... 78.3%
[gumbel] Running Gumbel Method... 78.4%
[gumbel] Running Gumbel Method... 78.5%
[gumbel] Running Gumbel Method... 78.5%
[gumbel] Running Gumbel Method... 78.6%
[gumbel] Running Gumbel Method... 78.7%
[gumbel] Running Gumbel Method... 78.8%
[gumbel] Running Gumbel Method... 78.9%
[gumbel] Running Gumbel Method... 79.0%
[gumbel] Running Gumbel Method... 79.1%
[gumbel] Running Gumbel Method... 79.2%
[gumbel] Running Gumbel Method... 79.3%
[gumbel] Running Gumbel Method... 79.4%
[gumbel] Running Gumbel Method... 79.5%
[gumbel] Running Gumbel Method... 79.5%
[gumbel] Running Gumbel Method... 79.6%
[gumbel] Running Gumbel Method... 79.7%
[gumbel] Running Gumbel Method... 79.8%
[gumbel] Running Gumbel Method... 79.9%
[gumbel] Running Gumbel Method... 80.0%
[gumbel] Running Gumbel Method... 80.1%
[gumbel] Running Gumbel Method... 80.2%
[gumbel] Running Gumbel Method... 80.3%
[gumbel] Running Gumbel Method... 80.4%
[gumbel] Running Gumbel Method... 80.5%
[gumbel] Running Gumbel Method... 80.5%
[gumbel] Running Gumbel Method... 80.6%
[gumbel] Running Gumbel Method... 80.7%
[gumbel] Running Gumbel Method... 80.8%
[gumbel] Running Gumbel Method... 80.9%
[gumbel] Running Gumbel Method... 81.0%
[gumbel] Running Gumbel Method... 81.1%
[gumbel] Running Gumbel Method... 81.2%
[gumbel] Running Gumbel Method... 81.3%
[gumbel] Running Gumbel Method... 81.4%
[gumbel] Running Gumbel Method... 81.5%
[gumbel] Running Gumbel Method... 81.5%
[gumbel] Running Gumbel Method... 81.6%
[gumbel] Running Gumbel Method... 81.7%
[gumbel] Running Gumbel Method... 81.8%
[gumbel] Running Gumbel Method... 81.9%
[gumbel] Running Gumbel Method... 82.0%
[gumbel] Running Gumbel Method... 82.1%
[gumbel] Running Gumbel Method... 82.2%
[gumbel] Running Gumbel Method... 82.3%
[gumbel] Running Gumbel Method... 82.4%
[gumbel] Running Gumbel Method... 82.5%
[gumbel] Running Gumbel Method... 82.5%
[gumbel] Running Gumbel Method... 82.6%
[gumbel] Running Gumbel Method... 82.7%
[gumbel] Running Gumbel Method... 82.8%
[gumbel] Running Gumbel Method... 82.9%
[gumbel] Running Gumbel Method... 83.0%
[gumbel] Running Gumbel Method... 83.1%
[gumbel] Running Gumbel Method... 83.2%
[gumbel] Running Gumbel Method... 83.3%
[gumbel] Running Gumbel Method... 83.4%
[gumbel] Running Gumbel Method... 83.5%
[gumbel] Running Gumbel Method... 83.5%
[gumbel] Running Gumbel Method... 83.6%
[gumbel] Running Gumbel Method... 83.7%
[gumbel] Running Gumbel Method... 83.8%
[gumbel] Running Gumbel Method... 83.9%
[gumbel] Running Gumbel Method... 84.0%
[gumbel] Running Gumbel Method... 84.1%
[gumbel] Running Gumbel Method... 84.2%
[gumbel] Running Gumbel Method... 84.3%
[gumbel] Running Gumbel Method... 84.4%
[gumbel] Running Gumbel Method... 84.5%
[gumbel] Running Gumbel Method... 84.5%
[gumbel] Running Gumbel Method... 84.6%
[gumbel] Running Gumbel Method... 84.7%
[gumbel] Running Gumbel Method... 84.8%
[gumbel] Running Gumbel Method... 84.9%
[gumbel] Running Gumbel Method... 85.0%
[gumbel] Running Gumbel Method... 85.1%
[gumbel] Running Gumbel Method... 85.2%
[gumbel] Running Gumbel Method... 85.3%
[gumbel] Running Gumbel Method... 85.4%
[gumbel] Running Gumbel Method... 85.5%
[gumbel] Running Gumbel Method... 85.5%
[gumbel] Running Gumbel Method... 85.6%
[gumbel] Running Gumbel Method... 85.7%
[gumbel] Running Gumbel Method... 85.8%
[gumbel] Running Gumbel Method... 85.9%
[gumbel] Running Gumbel Method... 86.0%
[gumbel] Running Gumbel Method... 86.1%
[gumbel] Running Gumbel Method... 86.2%
[gumbel] Running Gumbel Method... 86.3%
[gumbel] Running Gumbel Method... 86.4%
[gumbel] Running Gumbel Method... 86.5%
[gumbel] Running Gumbel Method... 86.5%
[gumbel] Running Gumbel Method... 86.6%
[gumbel] Running Gumbel Method... 86.7%
[gumbel] Running Gumbel Method... 86.8%
[gumbel] Running Gumbel Method... 86.9%
[gumbel] Running Gumbel Method... 87.0%
[gumbel] Running Gumbel Method... 87.1%
[gumbel] Running Gumbel Method... 87.2%
[gumbel] Running Gumbel Method... 87.3%
[gumbel] Running Gumbel Method... 87.4%
[gumbel] Running Gumbel Method... 87.5%
[gumbel] Running Gumbel Method... 87.5%
[gumbel] Running Gumbel Method... 87.6%
[gumbel] Running Gumbel Method... 87.7%
[gumbel] Running Gumbel Method... 87.8%
[gumbel] Running Gumbel Method... 87.9%
[gumbel] Running Gumbel Method... 88.0%
[gumbel] Running Gumbel Method... 88.1%
[gumbel] Running Gumbel Method... 88.2%
[gumbel] Running Gumbel Method... 88.3%
[gumbel] Running Gumbel Method... 88.4%
[gumbel] Running Gumbel Method... 88.5%
[gumbel] Running Gumbel Method... 88.5%
[gumbel] Running Gumbel Method... 88.6%
[gumbel] Running Gumbel Method... 88.7%
[gumbel] Running Gumbel Method... 88.8%
[gumbel] Running Gumbel Method... 88.9%
[gumbel] Running Gumbel Method... 89.0%
[gumbel] Running Gumbel Method... 89.1%
[gumbel] Running Gumbel Method... 89.2%
[gumbel] Running Gumbel Method... 89.3%
[gumbel] Running Gumbel Method... 89.4%
[gumbel] Running Gumbel Method... 89.5%
[gumbel] Running Gumbel Method... 89.5%
[gumbel] Running Gumbel Method... 89.6%
[gumbel] Running Gumbel Method... 89.7%
[gumbel] Running Gumbel Method... 89.8%
[gumbel] Running Gumbel Method... 89.9%
[gumbel] Running Gumbel Method... 90.0%
[gumbel] Running Gumbel Method... 90.1%
[gumbel] Running Gumbel Method... 90.2%
[gumbel] Running Gumbel Method... 90.3%
[gumbel] Running Gumbel Method... 90.4%
[gumbel] Running Gumbel Method... 90.5%
[gumbel] Running Gumbel Method... 90.5%
[gumbel] Running Gumbel Method... 90.6%
[gumbel] Running Gumbel Method... 90.7%
[gumbel] Running Gumbel Method... 90.8%
[gumbel] Running Gumbel Method... 90.9%
[gumbel] Running Gumbel Method... 91.0%
[gumbel] Running Gumbel Method... 91.1%
[gumbel] Running Gumbel Method... 91.2%
[gumbel] Running Gumbel Method... 91.3%
[gumbel] Running Gumbel Method... 91.4%
[gumbel] Running Gumbel Method... 91.5%
[gumbel] Running Gumbel Method... 91.5%
[gumbel] Running Gumbel Method... 91.6%
[gumbel] Running Gumbel Method... 91.7%
[gumbel] Running Gumbel Method... 91.8%
[gumbel] Running Gumbel Method... 91.9%
[gumbel] Running Gumbel Method... 92.0%
[gumbel] Running Gumbel Method... 92.1%
[gumbel] Running Gumbel Method... 92.2%
[gumbel] Running Gumbel Method... 92.3%
[gumbel] Running Gumbel Method... 92.4%
[gumbel] Running Gumbel Method... 92.5%
[gumbel] Running Gumbel Method... 92.5%
[gumbel] Running Gumbel Method... 92.6%
[gumbel] Running Gumbel Method... 92.7%
[gumbel] Running Gumbel Method... 92.8%
[gumbel] Running Gumbel Method... 92.9%
[gumbel] Running Gumbel Method... 93.0%
[gumbel] Running Gumbel Method... 93.1%
[gumbel] Running Gumbel Method... 93.2%
[gumbel] Running Gumbel Method... 93.3%
[gumbel] Running Gumbel Method... 93.4%
[gumbel] Running Gumbel Method... 93.5%
[gumbel] Running Gumbel Method... 93.5%
[gumbel] Running Gumbel Method... 93.6%
[gumbel] Running Gumbel Method... 93.7%
[gumbel] Running Gumbel Method... 93.8%
[gumbel] Running Gumbel Method... 93.9%
[gumbel] Running Gumbel Method... 94.0%
[gumbel] Running Gumbel Method... 94.1%
[gumbel] Running Gumbel Method... 94.2%
[gumbel] Running Gumbel Method... 94.3%
[gumbel] Running Gumbel Method... 94.4%
[gumbel] Running Gumbel Method... 94.5%
[gumbel] Running Gumbel Method... 94.5%
[gumbel] Running Gumbel Method... 94.6%
[gumbel] Running Gumbel Method... 94.7%
[gumbel] Running Gumbel Method... 94.8%
[gumbel] Running Gumbel Method... 94.9%
[gumbel] Running Gumbel Method... 95.0%
[gumbel] Running Gumbel Method... 95.1%
[gumbel] Running Gumbel Method... 95.2%
[gumbel] Running Gumbel Method... 95.3%
[gumbel] Running Gumbel Method... 95.4%
[gumbel] Running Gumbel Method... 95.5%
[gumbel] Running Gumbel Method... 95.5%
[gumbel] Running Gumbel Method... 95.6%
[gumbel] Running Gumbel Method... 95.7%
[gumbel] Running Gumbel Method... 95.8%
[gumbel] Running Gumbel Method... 95.9%
[gumbel] Running Gumbel Method... 96.0%
[gumbel] Running Gumbel Method... 96.1%
[gumbel] Running Gumbel Method... 96.2%
[gumbel] Running Gumbel Method... 96.3%
[gumbel] Running Gumbel Method... 96.4%
[gumbel] Running Gumbel Method... 96.5%
[gumbel] Running Gumbel Method... 96.5%
[gumbel] Running Gumbel Method... 96.6%
[gumbel] Running Gumbel Method... 96.7%
[gumbel] Running Gumbel Method... 96.8%
[gumbel] Running Gumbel Method... 96.9%
[gumbel] Running Gumbel Method... 97.0%
[gumbel] Running Gumbel Method... 97.1%
[gumbel] Running Gumbel Method... 97.2%
[gumbel] Running Gumbel Method... 97.3%
[gumbel] Running Gumbel Method... 97.4%
[gumbel] Running Gumbel Method... 97.5%
[gumbel] Running Gumbel Method... 97.5%
[gumbel] Running Gumbel Method... 97.6%
[gumbel] Running Gumbel Method... 97.7%
[gumbel] Running Gumbel Method... 97.8%
[gumbel] Running Gumbel Method... 97.9%
[gumbel] Running Gumbel Method... 98.0%
[gumbel] Running Gumbel Method... 98.1%
[gumbel] Running Gumbel Method... 98.2%
[gumbel] Running Gumbel Method... 98.3%
[gumbel] Running Gumbel Method... 98.4%
[gumbel] Running Gumbel Method... 98.5%
[gumbel] Running Gumbel Method... 98.5%
[gumbel] Running Gumbel Method... 98.6%
[gumbel] Running Gumbel Method... 98.7%
[gumbel] Running Gumbel Method... 98.8%
[gumbel] Running Gumbel Method... 98.9%
[gumbel] Running Gumbel Method... 99.0%
[gumbel] Running Gumbel Method... 99.1%
[gumbel] Running Gumbel Method... 99.2%
[gumbel] Running Gumbel Method... 99.3%
[gumbel] Running Gumbel Method... 99.4%
[gumbel] Running Gumbel Method... 99.5%
[gumbel] Running Gumbel Method... 99.5%
[gumbel] Running Gumbel Method... 99.6%
[gumbel] Running Gumbel Method... 99.7%
[gumbel] Running Gumbel Method... 99.8%
[gumbel] Running Gumbel Method... 99.9%
[gumbel] Running Gumbel Method... 100.0%
ok
test_HMM (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/hmm.py:194: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
T = len([1 for line in open(ctrldata[0]).readlines() if not line.startswith("#")])
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[gumbel]
[gumbel] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[gumbel] Finished Gumbel Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_HMM
####################
[hmm] Starting HMM Method
[hmm] Getting Data
[hmm] Normalizing using: TTR
[hmm] Running HMM Method... 2.5%
[hmm] Running HMM Method... 5.0%
[hmm] Running HMM Method... 7.5%
[hmm] Running HMM Method... 10.0%
[hmm] Running HMM Method... 12.5%
[hmm] Running HMM Method... 15.0%
[hmm] Running HMM Method... 17.5%
[hmm] Running HMM Method... 20.0%
[hmm] Running HMM Method... 22.5%
[hmm] Running HMM Method... 25.0%
[hmm] Running HMM Method... 27.5%
[hmm] Running HMM Method... 30.0%
[hmm] Running HMM Method... 32.5%
[hmm] Running HMM Method... 35.0%
[hmm] Running HMM Method... 37.5%
[hmm] Running HMM Method... 40.0%
[hmm] Running HMM Method... 42.5%
[hmm] Running HMM Method... 45.0%
[hmm] Running HMM Method... 47.5%
[hmm] Running HMM Method... 50.0%
[hmm] Running HMM Method... 50.0%
[hmm] Running HMM Method... 52.5%
[hmm] Running HMM Method... 55.0%
[hmm] Running HMM Method... 57.5%
[hmm] Running HMM Method... 60.0%
[hmm] Running HMM Method... 62.5%
[hmm] Running HMM Method... 65.0%
[hmm] Running HMM Method... 67.5%
[hmm] Running HMM Method... 70.0%
[hmm] Running HMM Method... 72.5%
[hmm] Running HMM Method... 75.0%
[hmm] Running HMM Method... 77.5%
[hmm] Running HMM Method... 80.0%
[hmm] Running HMM Method... 82.5%
[hmm] Running HMM Method... 85.0%
[hmm] Running HMM Method... 87.5%
[hmm] Running HMM Method... 90.0%
[hmm] Running HMM Method... 92.5%
[hmm] Running HMM Method... 95.0%
[hmm] Running HMM Method... 97.5%
ok
test_anova (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:121: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(fname):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[hmm]
[hmm] Finished HMM - Sites Method
[hmm] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[hmm] Creating HMM Genes Level Output
[hmm] Adding File: /<<PKGBUILDDIR>>/tests/testoutput_genes.txt
[hmm] Finished HMM Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_anova
####################
[anova] Starting Anova analysis
[anova] Getting Data
[anova] Normalizing using: TTR
[anova] Running Anova
[anova] Running Anova Method... 2.0%
[anova] Running Anova Method... 3.9%
[anova] Running Anova Method... 5.9%
[anova] Running Anova Method... 7.8%
[anova] Running Anova Method... 9.8%
[anova] Running Anova Method... 11.8%
[anova] Running Anova Method... 13.7%
[anova] Running Anova Method... 15.7%
[anova] Running Anova Method... 17.6%
[anova] Running Anova Method... 19.6%
[anova] Running Anova Method... 21.6%
[anova] Running Anova Method... 23.5%
[anova] Running Anova Method... 25.5%
[anova] Running Anova Method... 27.5%
[anova] Running Anova Method... 29.4%
[anova] Running Anova Method... 31.4%
[anova] Running Anova Method... 33.3%
[anova] Running Anova Method... 35.3%
[anova] Running Anova Method... 37.3%
[anova] Running Anova Method... 39.2%
[anova] Running Anova Method... 41.2%
[anova] Running Anova Method... 43.1%
[anova] Running Anova Method... 45.1%
[anova] Running Anova Method... 47.1%
[anova] Running Anova Method... 49.0%
[anova] Running Anova Method... 51.0%
[anova] Running Anova Method... 52.9%
[anova] Running Anova Method... 54.9%
[anova] Running Anova Method... 56.9%
[anova] Running Anova Method... 58.8%
[anova] Running Anova Method... 60.8%
[anova] Running Anova Method... 62.7%
[anova] Running Anova Method... 64.7%
[anova] Running Anova Method... 66.7%
[anova] Running Anova Method... 68.6%
[anova] Running Anova Method... 70.6%
[anova] Running Anova Method... 72.5%
[anova] Running Anova Method... 74.5%
[anova] Running Anova Method... 76.5%
[anova] Running Anova Method... 78.4%
[anova] Running Anova Method... 80.4%
[anova] Running Anova Method... 82.4%
[anova] Running Anova Method... 84.3%
[anova] Running Anova Method... 86.3%
[anova] Running Anova Method... 88.2%
[anova] Running Anova Method... 90.2%
[anova] Running Anova Method... 92.2%
[anova] Running Anova Method... 94.1%
[anova] Running Anova Method... 96.1%
[anova] Running Anova Method... 98.0%
[anova] Running Anova Method... 100.0%
/<<PKGBUILDDIR>>/tests/transit_test.py:89: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='r' encoding='UTF-8'>
for line in open(fname):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_resampling (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
for line in open(self.annotation):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[anova] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[anova] Finished Anova analysis
[anova] Time: 5.7s
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_resampling
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Performing LOESS Correction
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Performing LOESS Correction
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
/<<PKGBUILDDIR>>/tests/transit_test.py:89: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='r' encoding='UTF-8'>
for line in open(fname):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_resampling_adaptive (tests.test_analysis_methods.TestMethods) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/stat_tools.py:717: VisibleDeprecationWarning: Creating an ndarray from ragged nested sequences (which is a list-or-tuple of lists-or-tuples-or ndarrays with different lengths or shapes) is deprecated. If you meant to do this, you must specify 'dtype=object' when creating the ndarray
DATA[K] = numpy.array([L1[K], L2[K]])
/<<PKGBUILDDIR>>/tests/../src/pytransit/stat_tools.py:515: VisibleDeprecationWarning: Creating an ndarray from ragged nested sequences (which is a list-or-tuple of lists-or-tuples-or ndarrays with different lengths or shapes) is deprecated. If you meant to do this, you must specify 'dtype=object' when creating the ndarray
E[L] = numpy.array([perm[:n1], perm[n1:]])
[resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_resampling_adaptive
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_combined_wig (tests.test_analysis_methods.TestMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_resampling_combined_wig
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_histogram (tests.test_analysis_methods.TestMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
36
35
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_resampling_histogram
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_multistrain (tests.test_analysis_methods.TestMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing histogram files
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_resampling_multistrain
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Multiple annotation files found
[resampling] Mapping ctrl data to /<<PKGBUILDDIR>>/tests/data/test.prot_table, exp data to /<<PKGBUILDDIR>>/tests/data/test.prot_table
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_utest (tests.test_analysis_methods.TestMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing histogram files
Removing output file...
####################
tests.test_analysis_methods.TestMethods.test_utest
####################
[utest] Starting Mann-Whitney U-test Method
[utest] Getting Data
[utest] Normalizing using: TTR
[utest] Running Mann-Whitney U-test Method... 2.0%
[utest] Running Mann-Whitney U-test Method... 3.9%
[utest] Running Mann-Whitney U-test Method... 5.9%
[utest] Running Mann-Whitney U-test Method... 7.8%
[utest] Running Mann-Whitney U-test Method... 9.8%
[utest] Running Mann-Whitney U-test Method... 11.8%
[utest] Running Mann-Whitney U-test Method... 13.7%
[utest] Running Mann-Whitney U-test Method... 15.7%
[utest] Running Mann-Whitney U-test Method... 17.6%
[utest] Running Mann-Whitney U-test Method... 19.6%
[utest] Running Mann-Whitney U-test Method... 21.6%
[utest] Running Mann-Whitney U-test Method... 23.5%
[utest] Running Mann-Whitney U-test Method... 25.5%
[utest] Running Mann-Whitney U-test Method... 27.5%
[utest] Running Mann-Whitney U-test Method... 29.4%
[utest] Running Mann-Whitney U-test Method... 31.4%
[utest] Running Mann-Whitney U-test Method... 33.3%
[utest] Running Mann-Whitney U-test Method... 35.3%
[utest] Running Mann-Whitney U-test Method... 37.3%
[utest] Running Mann-Whitney U-test Method... 39.2%
[utest] Running Mann-Whitney U-test Method... 41.2%
[utest] Running Mann-Whitney U-test Method... 43.1%
[utest] Running Mann-Whitney U-test Method... 45.1%
[utest] Running Mann-Whitney U-test Method... 47.1%
[utest] Running Mann-Whitney U-test Method... 49.0%
[utest] Running Mann-Whitney U-test Method... 51.0%
[utest] Running Mann-Whitney U-test Method... 52.9%
[utest] Running Mann-Whitney U-test Method... 54.9%
[utest] Running Mann-Whitney U-test Method... 56.9%
[utest] Running Mann-Whitney U-test Method... 58.8%
[utest] Running Mann-Whitney U-test Method... 60.8%
[utest] Running Mann-Whitney U-test Method... 62.7%
[utest] Running Mann-Whitney U-test Method... 64.7%
[utest] Running Mann-Whitney U-test Method... 66.7%
[utest] Running Mann-Whitney U-test Method... 68.6%
[utest] Running Mann-Whitney U-test Method... 70.6%
[utest] Running Mann-Whitney U-test Method... 72.5%
[utest] Running Mann-Whitney U-test Method... 74.5%
[utest] Running Mann-Whitney U-test Method... 76.5%
[utest] Running Mann-Whitney U-test Method... 78.4%
[utest] Running Mann-Whitney U-test Method... 80.4%
[utest] Running Mann-Whitney U-test Method... 82.4%
[utest] Running Mann-Whitney U-test Method... 84.3%
[utest] Running Mann-Whitney U-test Method... 86.3%
[utest] Running Mann-Whitney U-test Method... 88.2%
[utest] Running Mann-Whitney U-test Method... 90.2%
[utest] Running Mann-Whitney U-test Method... 92.2%
[utest] Running Mann-Whitney U-test Method... 94.1%
[utest] Running Mann-Whitney U-test Method... 96.1%
[utest] Running Mann-Whitney U-test Method... 98.0%
[utest] Running Mann-Whitney U-test Method... 100.0%
ok
test_zinb (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_zinb_covariates (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_zinb_interactions (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_TTR (tests.test_norm_methods.TestNormMethods) ... ok
test_nonorm (tests.test_norm_methods.TestNormMethods) ... ok
test_resampling_NZMean (tests.test_norm_methods.TestNormMethods) ... [utest]
[utest] Performing Benjamini-Hochberg Correction
[utest] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[utest] Finished Mann-Whitney U-test Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_TTR
####################
####################
tests.test_norm_methods.TestNormMethods.test_nonorm
####################
####################
tests.test_norm_methods.TestNormMethods.test_resampling_NZMean
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: nzmean
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: nzmean
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_Quantile (tests.test_norm_methods.TestNormMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_resampling_Quantile
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: quantile
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: quantile
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
/<<PKGBUILDDIR>>/tests/transit_test.py:75: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_resampling_TTR (tests.test_norm_methods.TestNormMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_resampling_TTR
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_TotReads (tests.test_norm_methods.TestNormMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_resampling_TotReads
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: totreads
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: totreads
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_ZINFNB (tests.test_norm_methods.TestNormMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_resampling_ZINFNB
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: zinfnb
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: zinfnb
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_resampling_nonorm (tests.test_norm_methods.TestNormMethods) ... [resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_norm_methods.TestNormMethods.test_resampling_nonorm
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Preprocessing Exp data...
[resampling] Running Resampling Method... 2.0%
[resampling] Running Resampling Method... 3.9%
[resampling] Running Resampling Method... 5.9%
[resampling] Running Resampling Method... 7.8%
[resampling] Running Resampling Method... 9.8%
[resampling] Running Resampling Method... 11.8%
[resampling] Running Resampling Method... 13.7%
[resampling] Running Resampling Method... 15.7%
[resampling] Running Resampling Method... 17.6%
[resampling] Running Resampling Method... 19.6%
[resampling] Running Resampling Method... 21.6%
[resampling] Running Resampling Method... 23.5%
[resampling] Running Resampling Method... 25.5%
[resampling] Running Resampling Method... 27.5%
[resampling] Running Resampling Method... 29.4%
[resampling] Running Resampling Method... 31.4%
[resampling] Running Resampling Method... 33.3%
[resampling] Running Resampling Method... 35.3%
[resampling] Running Resampling Method... 37.3%
[resampling] Running Resampling Method... 39.2%
[resampling] Running Resampling Method... 41.2%
[resampling] Running Resampling Method... 43.1%
[resampling] Running Resampling Method... 45.1%
[resampling] Running Resampling Method... 47.1%
[resampling] Running Resampling Method... 49.0%
[resampling] Running Resampling Method... 51.0%
[resampling] Running Resampling Method... 52.9%
[resampling] Running Resampling Method... 54.9%
[resampling] Running Resampling Method... 56.9%
[resampling] Running Resampling Method... 58.8%
[resampling] Running Resampling Method... 60.8%
[resampling] Running Resampling Method... 62.7%
[resampling] Running Resampling Method... 64.7%
[resampling] Running Resampling Method... 66.7%
[resampling] Running Resampling Method... 68.6%
[resampling] Running Resampling Method... 70.6%
[resampling] Running Resampling Method... 72.5%
[resampling] Running Resampling Method... 74.5%
[resampling] Running Resampling Method... 76.5%
[resampling] Running Resampling Method... 78.4%
[resampling] Running Resampling Method... 80.4%
[resampling] Running Resampling Method... 82.4%
[resampling] Running Resampling Method... 84.3%
[resampling] Running Resampling Method... 86.3%
[resampling] Running Resampling Method... 88.2%
[resampling] Running Resampling Method... 90.2%
[resampling] Running Resampling Method... 92.2%
[resampling] Running Resampling Method... 94.1%
[resampling] Running Resampling Method... 96.1%
[resampling] Running Resampling Method... 98.0%
[resampling] Running Resampling Method... 100.0%
ok
test_cleanargs_flag_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_flag_arguments_with_double_dash (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_flag_without_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_negative_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_positional_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_positional_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_file_types (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_genes_creation_fromdata (tests.test_pytransit_tools.TestTnSeqTools) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
for line in open(self.annotation):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_genes_creation_fromwig (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_normalization (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_read_data (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_tpp_flag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file'
test_tpp_multicontig_auto_replicon_ids (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq and
[tn_preprocess] protocol: Sassetti
[tn_preprocess] transposon type: Himar1
[tn_preprocess] One reference genome specified: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna, containing 3 records.
[tn_preprocess] Autogenerating replicon_ids...
[tn_preprocess] extracting reads...
[tn_preprocess] fastq2reads: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq -> /<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:85: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq' mode='r' encoding='UTF-8'>
for line in open(infile):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] assuming single-ended reads
[tn_preprocess] creating /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1
[tn_preprocess] prefix sequence:
[tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20]
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:276: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
for line in open(infile):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] mapping reads using BWA...(this takes a couple of minutes)
[tn_preprocess] /usr/bin/bwa index /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
b'[bwa_index] Pack FASTA... 0.47 sec'
b'[bwa_index] Construct BWT for the packed sequence...'
b'[bwa_index] 15.11 seconds elapse.'
b'[bwa_index] Update BWT... 0.39 sec'
b'[bwa_index] Pack forward-only FASTA... 0.31 sec'
b'[bwa_index] Construct SA from BWT and Occ... 12.61 sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa index /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna'
b'[main] Real time: 29.480 sec; CPU: 28.910 sec'
b''
[tn_preprocess] /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1 > /<<PKGBUILDDIR>>/tests/test_tpp_temp.sam
b'[M::bwa_idx_load_from_disk] read 0 ALT contigs'
b'[M::process] read 2500 sequences (304052 bp)...'
b'[M::mem_process_seqs] Processed 2500 reads in 1.960 CPU sec, 1.959 real sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1'
b'[main] Real time: 2.096 sec; CPU: 2.055 sec'
b''
[tn_preprocess] tabulating template counts and statistics for reference genome /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:378: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test-multicontig.fna' mode='r' encoding='UTF-8'>
for line in open(filename):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:560: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.sam' mode='r' encoding='UTF-8'>
for line in open(sam):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_1.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_2.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_3.wig
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1108: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
for line in open(vars.reads1):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1117: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
read_length = get_read_length(vars.base + ".reads1")
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1118: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1' mode='r' encoding='UTF-8'>
mean_r1_genomic = get_genomic_portion(vars.base + ".trimmed1")
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp.tn_stats
[tn_preprocess] Done.
ok
test_tpp_multicontig_empty_prefix (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq and
[tn_preprocess] protocol: Sassetti
[tn_preprocess] transposon type: Himar1
[tn_preprocess] One reference genome specified: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna, containing 3 records.
[tn_preprocess] extracting reads...
[tn_preprocess] fastq2reads: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq -> /<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1
[tn_preprocess] assuming single-ended reads
[tn_preprocess] creating /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1
[tn_preprocess] prefix sequence:
[tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20]
[tn_preprocess] mapping reads using BWA...(this takes a couple of minutes)
[tn_preprocess] /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1 > /<<PKGBUILDDIR>>/tests/test_tpp_temp.sam
b'[M::bwa_idx_load_from_disk] read 0 ALT contigs'
b'[M::process] read 2500 sequences (304052 bp)...'
b'[M::mem_process_seqs] Processed 2500 reads in 1.960 CPU sec, 1.961 real sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1'
b'[main] Real time: 2.124 sec; CPU: 2.050 sec'
b''
[tn_preprocess] tabulating template counts and statistics for reference genome /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_a.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_b.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_c.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp.tn_stats
[tn_preprocess] Done.
ok
test_tpp_noflag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file'
test_tpp_protocol_mme1 (tests.test_tpp.TestTPP) ... skipped 'requires local data file'
----------------------------------------------------------------------
Ran 39 tests in 2047.633s
OK (skipped=6)
[resampling]
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_w_quotes
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_with_double_dash
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_without_arguments
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_negative_arguments
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments_w_quotes
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_file_types
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromdata
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromwig
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_normalization
####################
####################
tests.test_pytransit_tools.TestTnSeqTools.test_read_data
####################
####################
tests.test_tpp.TestTPP.test_tpp_multicontig_auto_replicon_ids
####################
# title: Tn-Seq Pre-Processor
# date: 10/15/2021 06:51:49
# command: python python3.9 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py
# transposon type: Himar1
# protocol type: Sassetti
# bwa flags:
# read1: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq
# read2:
# ref_genome: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
# replicon_ids: 1,2,3
# total_reads (or read pairs): 2500
# trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512
# reads1_mapped: 2116
# reads2_mapped: 0
# mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116
# read_count (TA sites only, for Himar1):
# 1: 63
# 2: 0
# 3: 0
# template_count:
# 1: 63
# 2: 0
# 3: 0
# template_ratio (reads per template):
# 1: 1.00
# 2: 0.00
# 3: 0.00
# TA_sites:
# 1: 89994
# 2: 646
# 3: 664
# TAs_hit:
# 1: 63
# 2: 0
# 3: 0
# density:
# 1: 0.001
# 2: 0.000
# 3: 0.000
# max_count (among templates):
# 1: 1
# 2: 0
# 3: 0
# max_site (coordinate):
# 1: 4977050
# 2: 57441
# 3: 38111
# NZ_mean (among templates):
# 1: 1.0
# 2: 0.0
# 3: 0.0
# FR_corr (Fwd templates vs. Rev templates):
# 1: -0.000
# 2: nan
# 3: nan
# BC_corr (reads vs. templates, summed over both strands):
# 1: nan
# 2: nan
# 3: nan
# primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1)
# vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7)
# adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index)
# misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA
# read_length: 125 bp
# mean_R1_genomic_length: 121.6 bp
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
####################
tests.test_tpp.TestTPP.test_tpp_multicontig_empty_prefix
####################
# title: Tn-Seq Pre-Processor
# date: 10/15/2021 06:52:12
# command: python python3.9 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py
# transposon type: Himar1
# protocol type: Sassetti
# bwa flags:
# read1: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq
# read2:
# ref_genome: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
# replicon_ids: a,b,c
# total_reads (or read pairs): 2500
# trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512
# reads1_mapped: 2116
# reads2_mapped: 0
# mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116
# read_count (TA sites only, for Himar1):
# a: 63
# b: 0
# c: 0
# template_count:
# a: 63
# b: 0
# c: 0
# template_ratio (reads per template):
# a: 1.00
# b: 0.00
# c: 0.00
# TA_sites:
# a: 89994
# b: 646
# c: 664
# TAs_hit:
# a: 63
# b: 0
# c: 0
# density:
# a: 0.001
# b: 0.000
# c: 0.000
# max_count (among templates):
# a: 1
# b: 0
# c: 0
# max_site (coordinate):
# a: 4977050
# b: 57441
# c: 38111
# NZ_mean (among templates):
# a: 1.0
# b: 0.0
# c: 0.0
# FR_corr (Fwd templates vs. Rev templates):
# a: -0.000
# b: nan
# c: nan
# BC_corr (reads vs. templates, summed over both strands):
# a: nan
# b: nan
# c: nan
# primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1)
# vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7)
# adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index)
# misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA
# read_length: 125 bp
# mean_R1_genomic_length: 121.6 bp
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
create-stamp debian/debhelper-build-stamp
dh_testroot -a -O--buildsystem=pybuild
dh_prep -a -O--buildsystem=pybuild
dh_auto_install --destdir=debian/tnseq-transit/ -a -O--buildsystem=pybuild
I: pybuild base:232: /usr/bin/python3 setup.py install --root /<<PKGBUILDDIR>>/debian/tnseq-transit
running install
running build
running build_py
running egg_info
writing tnseq_transit.egg-info/PKG-INFO
writing dependency_links to tnseq_transit.egg-info/dependency_links.txt
writing entry points to tnseq_transit.egg-info/entry_points.txt
writing requirements to tnseq_transit.egg-info/requires.txt
writing top-level names to tnseq_transit.egg-info/top_level.txt
reading manifest file 'tnseq_transit.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no files found matching 'VERSION'
warning: no files found matching '*.html' under directory 'src/pytransit/doc/build/html'
warning: no files found matching '*.png' under directory 'src/pytransit/doc/build/html/_images'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_modules'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_static'
writing manifest file 'tnseq_transit.egg-info/SOURCES.txt'
running install_lib
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp/__init__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp/__main__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp/tpp_gui.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytpp/tpp_tools.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/__init__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/__main__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/draw_trash.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/fileDisplay.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/images.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/norm_tools.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/qcDisplay.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/stat_tools.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/tnseq_tools.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/transit_gui.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/transit_tools.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/trash.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/view_trash.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/__init__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/anova.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/base.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/binomial.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/corrplot.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/example.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/gi.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/griffin.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/gumbel.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/heatmap.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/hmm.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/norm.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/normalize.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/pathway_enrichment.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/rankproduct.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/resampling.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/tn5gaps.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/tnseq_stats.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/utest.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/analysis/zinb.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert/__init__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert/base.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/convert/gff_to_prot_table.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/__init__.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/base.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/combined_wig.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/igv.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/mean_counts.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/export/prot_table.py -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/COG_roles.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/GO_associated_Rvs-3-11-18.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/GO_associated_Rvs.csv -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/GO_term_names.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/GO_terms_for_each_Rv.obo-3-11-18.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv.sanger_associated_RVS.csv -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_COG_roles.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_GO_terms.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_sanger_roles.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/README.md -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep3.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_glycerol_combined.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/gene_ontology.1_2.3-11-18.obo -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg_covar.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg_interactions.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/sanger_roles.dat -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/data/smeg_GO_terms.txt -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data
creating /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/BCG.fna -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/BCG.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37Rv.fna -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37Rv.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD.fna -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD_mod3.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvMA2.fna -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvMA2.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/genomes.html -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/mc2_155_tamu.fna -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
copying /<<PKGBUILDDIR>>/.pybuild/cpython3_3.9/build/pytransit/genomes/mc2_155_tamu.prot_table -> /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/__init__.py to __init__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/__main__.py to __main__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/tpp_gui.py to tpp_gui.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/tpp_tools.py to tpp_tools.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/__init__.py to __init__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/__main__.py to __main__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/draw_trash.py to draw_trash.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/fileDisplay.py to fileDisplay.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/images.py to images.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/norm_tools.py to norm_tools.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/qcDisplay.py to qcDisplay.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/stat_tools.py to stat_tools.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/tnseq_tools.py to tnseq_tools.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/transit_gui.py to transit_gui.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/transit_tools.py to transit_tools.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/trash.py to trash.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/view_trash.py to view_trash.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/__init__.py to __init__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/anova.py to anova.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/base.py to base.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/binomial.py to binomial.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/corrplot.py to corrplot.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/example.py to example.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/gi.py to gi.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/griffin.py to griffin.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/gumbel.py to gumbel.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/heatmap.py to heatmap.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/hmm.py to hmm.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/norm.py to norm.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/normalize.py to normalize.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/pathway_enrichment.py to pathway_enrichment.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/rankproduct.py to rankproduct.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/resampling.py to resampling.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/tn5gaps.py to tn5gaps.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/tnseq_stats.py to tnseq_stats.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/utest.py to utest.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/zinb.py to zinb.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/__init__.py to __init__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/base.py to base.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/gff_to_prot_table.py to gff_to_prot_table.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/__init__.py to __init__.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/base.py to base.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/combined_wig.py to combined_wig.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/igv.py to igv.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/mean_counts.py to mean_counts.cpython-39.pyc
byte-compiling /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/prot_table.py to prot_table.cpython-39.pyc
running install_egg_info
Copying tnseq_transit.egg-info to /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/lib/python3.9/dist-packages/tnseq_transit-3.2.2.egg-info
Skipping SOURCES.txt
running install_scripts
Installing tpp script to /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/bin
Installing transit script to /<<PKGBUILDDIR>>/debian/tnseq-transit/usr/bin
debian/rules override_dh_install
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_install
mv debian/tnseq-transit/usr/bin/tpp debian/tnseq-transit/usr/bin/transit-tpp
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_installdocs -a -O--buildsystem=pybuild
dh_installchangelogs -a -O--buildsystem=pybuild
dh_installman -a -O--buildsystem=pybuild
dh_python3 -a -O--buildsystem=pybuild
dh_installsystemduser -a -O--buildsystem=pybuild
dh_perl -a -O--buildsystem=pybuild
dh_link -a -O--buildsystem=pybuild
dh_strip_nondeterminism -a -O--buildsystem=pybuild
dh_compress -a -O--buildsystem=pybuild
dh_fixperms -a -O--buildsystem=pybuild
dh_missing -a -O--buildsystem=pybuild
dh_dwz -a -O--buildsystem=pybuild
dh_strip -a -O--buildsystem=pybuild
dh_makeshlibs -a -O--buildsystem=pybuild
dh_shlibdeps -a -O--buildsystem=pybuild
dh_installdeb -a -O--buildsystem=pybuild
dh_gencontrol -a -O--buildsystem=pybuild
dh_md5sums -a -O--buildsystem=pybuild
dh_builddeb -a -O--buildsystem=pybuild
dpkg-deb: building package 'tnseq-transit' in '../tnseq-transit_3.2.2-1_armhf.deb'.
dpkg-genbuildinfo --build=any
dpkg-genchanges --build=any -mRaspbian wandboard test autobuilder <root@raspbian.org> >../tnseq-transit_3.2.2-1_armhf.changes
dpkg-genchanges: info: binary-only arch-specific upload (source code and arch-indep packages not included)
dpkg-source --after-build .
dpkg-buildpackage: info: binary-only upload (no source included)
--------------------------------------------------------------------------------
Build finished at 2021-10-15T06:56:01Z
Finished
--------
I: Built successfully
+------------------------------------------------------------------------------+
| Post Build Chroot |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Changes |
+------------------------------------------------------------------------------+
tnseq-transit_3.2.2-1_armhf.changes:
------------------------------------
Format: 1.8
Date: Tue, 12 Oct 2021 16:19:02 +0200
Source: tnseq-transit
Binary: tnseq-transit
Architecture: armhf
Version: 3.2.2-1
Distribution: bookworm-staging
Urgency: medium
Maintainer: Raspbian wandboard test autobuilder <root@raspbian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
tnseq-transit - statistical calculations of essentiality of genes or genomic regi
Changes:
tnseq-transit (3.2.2-1) unstable; urgency=medium
.
* Fix watchfile to detect new versions on github
* New upstream version
* Standards-Version: 4.6.0 (routine-update)
Checksums-Sha1:
96d9347112865329960cf529b246b3df6aba71ea 6870 tnseq-transit_3.2.2-1_armhf.buildinfo
da45538fc172b735c268edeb13725a8ef127f1dc 8959500 tnseq-transit_3.2.2-1_armhf.deb
Checksums-Sha256:
5b51da7c81df83ebd2d8e3ea146ddb415a44a686c4a739147d4c40f49061e96f 6870 tnseq-transit_3.2.2-1_armhf.buildinfo
9e39f9ae441c27d8de2a617b88a2cf1375cfe9049818e050fd96c09b673a9d69 8959500 tnseq-transit_3.2.2-1_armhf.deb
Files:
bde2e31a9867f009f95259caaa769ceb 6870 science optional tnseq-transit_3.2.2-1_armhf.buildinfo
02a1c4f61c64dea8a90186c183be0588 8959500 science optional tnseq-transit_3.2.2-1_armhf.deb
+------------------------------------------------------------------------------+
| Package contents |
+------------------------------------------------------------------------------+
tnseq-transit_3.2.2-1_armhf.deb
-------------------------------
new Debian package, version 2.0.
size 8959500 bytes: control archive=3920 bytes.
1383 bytes, 28 lines control
8948 bytes, 95 lines md5sums
251 bytes, 12 lines * postinst #!/bin/sh
400 bytes, 12 lines * prerm #!/bin/sh
Package: tnseq-transit
Version: 3.2.2-1
Architecture: armhf
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Installed-Size: 76921
Depends: python3-matplotlib, python3-numpy, python3-pil, python3-pkg-resources, python3-pubsub, python3-scipy, python3-statsmodels, python3-wxgtk4.0, python3:any, bwa
Breaks: transit
Replaces: transit
Provides: transit
Section: science
Priority: optional
Homepage: http://saclab.tamu.edu/essentiality/transit/
Description: statistical calculations of essentiality of genes or genomic regions
This is a software that can be used to analyze Tn-Seq datasets. It
includes various statistical calculations of essentiality of genes or
genomic regions (including conditional essentiality between 2
conditions). These methods were developed and tested as a collaboration
between the Sassetti lab (UMass) and the Ioerger lab (Texas A&M)
.
TRANSIT is capable of analyzing TnSeq libraries constructed with Himar1
or Tn5 datasets.
.
TRANSIT assumes you have already done pre-processing of raw sequencing
files (.fastq) and extracted read counts into a .wig formatted file.
The .wig file should contain the counts at all sites where an insertion
could take place (including sites with no reads). For Himar1 datasets
this is all TA sites in the genome. For Tn5 datasets this would be all
nucleotides in the genome.
drwxr-xr-x root/root 0 2021-10-12 14:19 ./
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/bin/
-rwxr-xr-x root/root 976 2021-10-12 14:19 ./usr/bin/transit
-rwxr-xr-x root/root 968 2021-10-12 14:19 ./usr/bin/transit-tpp
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytpp/
-rw-r--r-- root/root 1 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytpp/__init__.py
-rw-r--r-- root/root 3655 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytpp/__main__.py
-rw-r--r-- root/root 25744 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytpp/tpp_gui.py
-rw-r--r-- root/root 56458 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytpp/tpp_tools.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/
-rw-r--r-- root/root 119 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/__init__.py
-rw-r--r-- root/root 4950 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/__main__.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/analysis/
-rw-r--r-- root/root 1931 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/__init__.py
-rw-r--r-- root/root 10746 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/anova.py
-rw-r--r-- root/root 20519 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/base.py
-rw-r--r-- root/root 20720 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/binomial.py
-rw-r--r-- root/root 6502 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/corrplot.py
-rw-r--r-- root/root 7621 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/example.py
-rw-r--r-- root/root 40031 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/gi.py
-rw-r--r-- root/root 10076 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/griffin.py
-rw-r--r-- root/root 21117 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/gumbel.py
-rw-r--r-- root/root 6939 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/heatmap.py
-rw-r--r-- root/root 22887 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/hmm.py
-rw-r--r-- root/root 3925 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/norm.py
-rw-r--r-- root/root 5122 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/normalize.py
-rw-r--r-- root/root 21378 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/pathway_enrichment.py
-rw-r--r-- root/root 13656 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/rankproduct.py
-rw-r--r-- root/root 31681 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/resampling.py
-rw-r--r-- root/root 15334 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/tn5gaps.py
-rw-r--r-- root/root 5122 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/tnseq_stats.py
-rw-r--r-- root/root 14596 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/utest.py
-rw-r--r-- root/root 31015 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/analysis/zinb.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/convert/
-rw-r--r-- root/root 330 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/convert/__init__.py
-rw-r--r-- root/root 5996 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/convert/base.py
-rw-r--r-- root/root 5761 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/convert/gff_to_prot_table.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/data/
-rw-r--r-- root/root 939 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/COG_roles.dat
-rw-r--r-- root/root 469931 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/GO_associated_Rvs-3-11-18.txt
-rw-r--r-- root/root 285249 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/GO_associated_Rvs.csv
-rw-r--r-- root/root 2582004 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/GO_term_names.dat
-rw-r--r-- root/root 2043959 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/GO_terms_for_each_Rv.obo-3-11-18.txt
-rw-r--r-- root/root 32738 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/H37Rv.sanger_associated_RVS.csv
-rw-r--r-- root/root 146196 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/H37Rv_COG_roles.dat
-rw-r--r-- root/root 2043959 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/H37Rv_GO_terms.txt
-rw-r--r-- root/root 102346 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/H37Rv_sanger_roles.dat
-rw-r--r-- root/root 2154 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/README.md
-rw-r--r-- root/root 785384 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/cholesterol_H37Rv_merged.wig
-rw-r--r-- root/root 766014 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/cholesterol_H37Rv_rep1.wig
-rw-r--r-- root/root 762998 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/cholesterol_H37Rv_rep2.wig
-rw-r--r-- root/root 757561 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/cholesterol_H37Rv_rep3.wig
-rw-r--r-- root/root 3189503 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/cholesterol_glycerol_combined.dat
-rw-r--r-- root/root 33810329 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/gene_ontology.1_2.3-11-18.obo
-rw-r--r-- root/root 789627 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/glycerol_H37Rv_merged.wig
-rw-r--r-- root/root 766649 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/glycerol_H37Rv_rep1.wig
-rw-r--r-- root/root 779802 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/glycerol_H37Rv_rep2.wig
-rw-r--r-- root/root 315 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/samples_metadata_cg.txt
-rw-r--r-- root/root 342 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/samples_metadata_cg_covar.txt
-rw-r--r-- root/root 364 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/samples_metadata_cg_interactions.txt
-rw-r--r-- root/root 3737 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/sanger_roles.dat
-rw-r--r-- root/root 593832 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/data/smeg_GO_terms.txt
-rw-r--r-- root/root 12680 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/draw_trash.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/export/
-rw-r--r-- root/root 480 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/__init__.py
-rw-r--r-- root/root 8406 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/base.py
-rw-r--r-- root/root 6750 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/combined_wig.py
-rw-r--r-- root/root 6268 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/igv.py
-rw-r--r-- root/root 7431 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/mean_counts.py
-rw-r--r-- root/root 0 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/export/prot_table.py
-rw-r--r-- root/root 9072 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/fileDisplay.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/pytransit/genomes/
-rw-r--r-- root/root 4437109 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/BCG.fna
-rw-r--r-- root/root 375487 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/BCG.prot_table
-rw-r--r-- root/root 4474634 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37Rv.fna
-rw-r--r-- root/root 392954 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37Rv.prot_table
-rw-r--r-- root/root 4474815 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37RvBD.fna
-rw-r--r-- root/root 270695 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37RvBD.prot_table
-rw-r--r-- root/root 273441 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37RvBD_mod3.prot_table
-rw-r--r-- root/root 4473973 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37RvMA2.fna
-rw-r--r-- root/root 335664 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/H37RvMA2.prot_table
-rw-r--r-- root/root 1245 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/genomes.html
-rw-r--r-- root/root 7088449 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/mc2_155_tamu.fna
-rw-r--r-- root/root 639545 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/genomes/mc2_155_tamu.prot_table
-rw-r--r-- root/root 19972 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/images.py
-rw-r--r-- root/root 27508 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/norm_tools.py
-rw-r--r-- root/root 15294 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/qcDisplay.py
-rw-r--r-- root/root 24524 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/stat_tools.py
-rw-r--r-- root/root 50341 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/tnseq_tools.py
-rw-r--r-- root/root 81700 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/transit_gui.py
-rw-r--r-- root/root 18576 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/transit_tools.py
-rw-r--r-- root/root 14178 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/trash.py
-rw-r--r-- root/root 9138 2021-09-07 20:32 ./usr/lib/python3/dist-packages/pytransit/view_trash.py
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/
-rw-r--r-- root/root 4469 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/PKG-INFO
-rw-r--r-- root/root 1 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/dependency_links.txt
-rw-r--r-- root/root 87 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/entry_points.txt
-rw-r--r-- root/root 0 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/requires.txt
-rw-r--r-- root/root 16 2021-10-12 14:19 ./usr/lib/python3/dist-packages/tnseq_transit-3.2.2.egg-info/top_level.txt
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/share/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/share/doc/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/share/doc/tnseq-transit/
-rw-r--r-- root/root 218 2021-10-12 14:19 ./usr/share/doc/tnseq-transit/README.Debian
-rw-r--r-- root/root 1286 2021-10-12 14:19 ./usr/share/doc/tnseq-transit/changelog.Debian.gz
-rw-r--r-- root/root 6573 2021-09-07 20:32 ./usr/share/doc/tnseq-transit/changelog.gz
-rw-r--r-- root/root 926 2021-10-12 14:19 ./usr/share/doc/tnseq-transit/copyright
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/share/man/
drwxr-xr-x root/root 0 2021-10-12 14:19 ./usr/share/man/man1/
-rw-r--r-- root/root 841 2021-10-12 14:19 ./usr/share/man/man1/transit-tpp.1.gz
-rw-r--r-- root/root 457 2021-10-12 14:19 ./usr/share/man/man1/transit.1.gz
+------------------------------------------------------------------------------+
| Post Build |
+------------------------------------------------------------------------------+
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: armhf
Build-Space: 267388
Build-Time: 2323
Distribution: bookworm-staging
Host Architecture: armhf
Install-Time: 951
Job: tnseq-transit_3.2.2-1
Machine Architecture: armhf
Package: tnseq-transit
Package-Time: 3341
Source-Version: 3.2.2-1
Space: 267388
Status: successful
Version: 3.2.2-1
--------------------------------------------------------------------------------
Finished at 2021-10-15T06:56:01Z
Build needed 00:55:41, 267388k disc space