Build log for tnseq-transit (3.1.0-2) on armhf

tnseq-transit → 3.1.0-2 → armhf → 2020-08-28 04:43:59

sbuild (Debian sbuild) 0.71.0 (24 Aug 2016) on bm-wb-03

+==============================================================================+
| tnseq-transit 3.1.0-2 (armhf)                Fri, 28 Aug 2020 04:01:49 +0000 |
+==============================================================================+

Package: tnseq-transit
Version: 3.1.0-2
Source Version: 3.1.0-2
Distribution: bullseye-staging
Machine Architecture: armhf
Host Architecture: armhf
Build Architecture: armhf

I: NOTICE: Log filtering will replace 'var/lib/schroot/mount/bullseye-staging-armhf-sbuild-8773090d-7e2e-4118-b4cd-b52042719dda' with '<<CHROOT>>'

+------------------------------------------------------------------------------+
| Update chroot                                                                |
+------------------------------------------------------------------------------+

Get:1 http://172.17.0.1/private bullseye-staging InRelease [11.3 kB]
Get:2 http://172.17.0.1/private bullseye-staging/main Sources [11.8 MB]
Get:3 http://172.17.0.1/private bullseye-staging/main armhf Packages [12.9 MB]
Fetched 24.8 MB in 24s (1036 kB/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges

+------------------------------------------------------------------------------+
| Fetch source files                                                           |
+------------------------------------------------------------------------------+


Check APT
---------

Checking available source versions...

Download source files with APT
------------------------------

Reading package lists...
NOTICE: 'tnseq-transit' packaging is maintained in the 'Git' version control system at:
https://salsa.debian.org/med-team/tnseq-transit.git
Please use:
git clone https://salsa.debian.org/med-team/tnseq-transit.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 22.0 MB of source archives.
Get:1 http://172.17.0.1/private bullseye-staging/main tnseq-transit 3.1.0-2 (dsc) [2183 B]
Get:2 http://172.17.0.1/private bullseye-staging/main tnseq-transit 3.1.0-2 (tar) [22.0 MB]
Get:3 http://172.17.0.1/private bullseye-staging/main tnseq-transit 3.1.0-2 (diff) [5760 B]
Fetched 22.0 MB in 2s (12.0 MB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/tnseq-transit-2jjUZw/tnseq-transit-3.1.0' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/tnseq-transit-2jjUZw' with '<<BUILDDIR>>'

+------------------------------------------------------------------------------+
| Install build-essential                                                      |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-EDjCZm/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning:   sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
gpg: keybox '/<<BUILDDIR>>/resolver-EDjCZm/gpg/pubring.kbx' created
gpg: /<<BUILDDIR>>/resolver-EDjCZm/gpg/trustdb.gpg: trustdb created
gpg: key 35506D9A48F77B2E: public key "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" imported
gpg: Total number processed: 1
gpg:               imported: 1
gpg: key 35506D9A48F77B2E: "Sbuild Signer (Sbuild Build Dependency Archive Key) <buildd-tools-devel@lists.alioth.debian.org>" not changed
gpg: key 35506D9A48F77B2E: secret key imported
gpg: Total number processed: 1
gpg:              unchanged: 1
gpg:       secret keys read: 1
gpg:   secret keys imported: 1
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Release [957 B]
Get:3 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Packages [432 B]
Fetched 2108 B in 1s (2661 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...

Install core build dependencies (apt-based resolver)
----------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following packages were automatically installed and are no longer required:
  bsdextrautils netbase sensible-utils
Use 'apt autoremove' to remove them.
The following NEW packages will be installed:
  sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 34 not upgraded.
Need to get 848 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [848 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 848 B in 0s (18.1 kB/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 12517 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...
W: No sandbox user '_apt' on the system, can not drop privileges

+------------------------------------------------------------------------------+
| Check architectures                                                          |
+------------------------------------------------------------------------------+

Arch check ok (armhf included in any)

+------------------------------------------------------------------------------+
| Install package build dependencies                                           |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: debhelper-compat (= 13), dh-python, python3-dev, python3-setuptools, python3-numpy, python3-scipy, python3-pil, python3-matplotlib, python3-statsmodels, python3-pubsub, bwa
Filtered Build-Depends: debhelper-compat (= 13), dh-python, python3-dev, python3-setuptools, python3-numpy, python3-scipy, python3-pil, python3-matplotlib, python3-statsmodels, python3-pubsub, bwa
dpkg-deb: building package 'sbuild-build-depends-tnseq-transit-dummy' in '/<<BUILDDIR>>/resolver-EDjCZm/apt_archive/sbuild-build-depends-tnseq-transit-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning:   sbuild-build-depends-core-dummy sbuild-build-depends-tnseq-transit-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
gpg: using "Sbuild Signer" as default secret key for signing
Ign:1 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Release [963 B]
Get:3 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Release.gpg [370 B]
Get:4 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Sources [556 B]
Get:5 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ Packages [639 B]
Fetched 2528 B in 1s (3103 B/s)
Reading package lists...
W: No sandbox user '_apt' on the system, can not drop privileges
Reading package lists...

Install tnseq-transit build dependencies (apt-based resolver)
-------------------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following package was automatically installed and is no longer required:
  netbase
Use 'apt autoremove' to remove it.
The following additional packages will be installed:
  autoconf automake autopoint autotools-dev bwa cpp-10 debhelper dh-autoreconf
  dh-python dh-strip-nondeterminism dwz file fonts-lyx g++-10 gcc-10
  gcc-10-base gettext gettext-base groff-base intltool-debian
  libarchive-zip-perl libasan6 libatomic1 libblas3 libbrotli1 libbsd0 libcc1-0
  libcroco3 libdebhelper-perl libelf1 libexpat1 libexpat1-dev
  libfile-stripnondeterminism-perl libfreetype6 libgcc-10-dev libgcc-s1
  libgfortran5 libglib2.0-0 libgomp1 libicu67 libimagequant0 libjbig0
  libjpeg62-turbo libjs-jquery libjs-jquery-ui liblapack3 liblbfgsb0
  liblcms2-2 libmagic-mgc libmagic1 libpipeline1 libpng16-16 libpython3-dev
  libpython3-stdlib libpython3.8 libpython3.8-dev libpython3.8-minimal
  libpython3.8-stdlib libsigsegv2 libssl1.1 libstdc++-10-dev libstdc++6
  libsub-override-perl libtiff5 libtool libubsan1 libuchardet0 libwebp6
  libwebpdemux2 libwebpmux3 libxau6 libxcb1 libxdmcp6 libxml2 m4 man-db
  mime-support node-jquery po-debconf python-matplotlib-data python3
  python3-cycler python3-dateutil python3-decorator python3-dev
  python3-distutils python3-kiwisolver python3-lib2to3 python3-matplotlib
  python3-minimal python3-numpy python3-pandas python3-pandas-lib
  python3-patsy python3-pil python3-pkg-resources python3-pubsub
  python3-pyparsing python3-scipy python3-setuptools python3-six
  python3-statsmodels python3-statsmodels-lib python3-tz python3.8
  python3.8-dev python3.8-minimal ttf-bitstream-vera zlib1g-dev
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc samtools gcc-10-locales dh-make
  gcc-10-doc gettext-doc libasprintf-dev libgettextpo-dev groff
  libjs-jquery-ui-docs liblcms2-utils libstdc++-10-doc libtool-doc gfortran
  | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser
  libmail-box-perl python3-doc python3-tk python3-venv python-cycler-doc
  dvipng ffmpeg ghostscript gir1.2-gtk-3.0 inkscape ipython3 librsvg2-common
  python-matplotlib-doc python3-cairocffi python3-gi python3-gi-cairo
  python3-gobject python3-nose python3-pyqt5 python3-sip python3-tornado
  texlive-extra-utils texlive-latex-extra ttf-staypuft gfortran
  python-numpy-doc python3-pytest python3-numpy-dbg python-pandas-doc
  python-patsy-doc python-pil-doc python3-pil-dbg python-pyparsing-doc
  python-scipy-doc python-setuptools-doc python-statsmodels-doc python3.8-venv
  python3.8-doc binfmt-support
Recommended packages:
  curl | wget | lynx libarchive-cpio-perl libglib2.0-data shared-mime-info
  xdg-user-dirs javascript-common libltdl-dev libmail-sendmail-perl python3-tk
  python3-numexpr python3-tables python3-xlrd python3-openpyxl python3-xlwt
  python3-bs4 python3-html5lib python3-lxml python3-olefile python3-joblib
  python3-colorama python3-cvxopt
The following NEW packages will be installed:
  autoconf automake autopoint autotools-dev bwa debhelper dh-autoreconf
  dh-python dh-strip-nondeterminism dwz file fonts-lyx gettext gettext-base
  groff-base intltool-debian libarchive-zip-perl libblas3 libbrotli1 libbsd0
  libcroco3 libdebhelper-perl libelf1 libexpat1 libexpat1-dev
  libfile-stripnondeterminism-perl libfreetype6 libgfortran5 libglib2.0-0
  libicu67 libimagequant0 libjbig0 libjpeg62-turbo libjs-jquery
  libjs-jquery-ui liblapack3 liblbfgsb0 liblcms2-2 libmagic-mgc libmagic1
  libpipeline1 libpng16-16 libpython3-dev libpython3-stdlib libpython3.8
  libpython3.8-dev libpython3.8-minimal libpython3.8-stdlib libsigsegv2
  libssl1.1 libsub-override-perl libtiff5 libtool libuchardet0 libwebp6
  libwebpdemux2 libwebpmux3 libxau6 libxcb1 libxdmcp6 libxml2 m4 man-db
  mime-support node-jquery po-debconf python-matplotlib-data python3
  python3-cycler python3-dateutil python3-decorator python3-dev
  python3-distutils python3-kiwisolver python3-lib2to3 python3-matplotlib
  python3-minimal python3-numpy python3-pandas python3-pandas-lib
  python3-patsy python3-pil python3-pkg-resources python3-pubsub
  python3-pyparsing python3-scipy python3-setuptools python3-six
  python3-statsmodels python3-statsmodels-lib python3-tz python3.8
  python3.8-dev python3.8-minimal sbuild-build-depends-tnseq-transit-dummy
  ttf-bitstream-vera zlib1g-dev
The following packages will be upgraded:
  cpp-10 g++-10 gcc-10 gcc-10-base libasan6 libatomic1 libcc1-0 libgcc-10-dev
  libgcc-s1 libgomp1 libstdc++-10-dev libstdc++6 libubsan1
13 upgraded, 97 newly installed, 0 to remove and 21 not upgraded.
Need to get 97.0 MB/98.3 MB of archives.
After this operation, 276 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-EDjCZm/apt_archive ./ sbuild-build-depends-tnseq-transit-dummy 0.invalid.0 [920 B]
Get:2 http://172.17.0.1/private bullseye-staging/main armhf libcc1-0 armhf 10.2.0-5+rpi1 [31.7 kB]
Get:3 http://172.17.0.1/private bullseye-staging/main armhf gcc-10-base armhf 10.2.0-5+rpi1 [199 kB]
Get:4 http://172.17.0.1/private bullseye-staging/main armhf libgcc-s1 armhf 10.2.0-5+rpi1 [36.1 kB]
Get:5 http://172.17.0.1/private bullseye-staging/main armhf libgomp1 armhf 10.2.0-5+rpi1 [84.0 kB]
Get:6 http://172.17.0.1/private bullseye-staging/main armhf libatomic1 armhf 10.2.0-5+rpi1 [8168 B]
Get:7 http://172.17.0.1/private bullseye-staging/main armhf libasan6 armhf 10.2.0-5+rpi1 [301 kB]
Get:8 http://172.17.0.1/private bullseye-staging/main armhf libubsan1 armhf 10.2.0-5+rpi1 [115 kB]
Get:9 http://172.17.0.1/private bullseye-staging/main armhf g++-10 armhf 10.2.0-5+rpi1 [6784 kB]
Get:10 http://172.17.0.1/private bullseye-staging/main armhf libstdc++-10-dev armhf 10.2.0-5+rpi1 [1743 kB]
Get:11 http://172.17.0.1/private bullseye-staging/main armhf libgcc-10-dev armhf 10.2.0-5+rpi1 [683 kB]
Get:12 http://172.17.0.1/private bullseye-staging/main armhf gcc-10 armhf 10.2.0-5+rpi1 [12.2 MB]
Get:13 http://172.17.0.1/private bullseye-staging/main armhf cpp-10 armhf 10.2.0-5+rpi1 [6245 kB]
Get:14 http://172.17.0.1/private bullseye-staging/main armhf libstdc++6 armhf 10.2.0-5+rpi1 [408 kB]
Get:15 http://172.17.0.1/private bullseye-staging/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB]
Get:16 http://172.17.0.1/private bullseye-staging/main armhf groff-base armhf 1.22.4-5 [783 kB]
Get:17 http://172.17.0.1/private bullseye-staging/main armhf libpipeline1 armhf 1.5.3-1 [29.9 kB]
Get:18 http://172.17.0.1/private bullseye-staging/main armhf man-db armhf 2.9.3-2 [1269 kB]
Get:19 http://172.17.0.1/private bullseye-staging/main armhf libpython3.8-minimal armhf 3.8.5-2 [752 kB]
Get:20 http://172.17.0.1/private bullseye-staging/main armhf libexpat1 armhf 2.2.9-1 [71.5 kB]
Get:21 http://172.17.0.1/private bullseye-staging/main armhf python3.8-minimal armhf 3.8.5-2 [1628 kB]
Get:22 http://172.17.0.1/private bullseye-staging/main armhf python3-minimal armhf 3.8.2-3 [37.6 kB]
Get:23 http://172.17.0.1/private bullseye-staging/main armhf mime-support all 3.64 [37.8 kB]
Get:24 http://172.17.0.1/private bullseye-staging/main armhf libpython3.8-stdlib armhf 3.8.5-2 [1677 kB]
Get:25 http://172.17.0.1/private bullseye-staging/main armhf python3.8 armhf 3.8.5-2 [420 kB]
Get:26 http://172.17.0.1/private bullseye-staging/main armhf libpython3-stdlib armhf 3.8.2-3 [20.8 kB]
Get:27 http://172.17.0.1/private bullseye-staging/main armhf python3 armhf 3.8.2-3 [63.7 kB]
Get:28 http://172.17.0.1/private bullseye-staging/main armhf libmagic-mgc armhf 1:5.38-5 [262 kB]
Get:29 http://172.17.0.1/private bullseye-staging/main armhf libmagic1 armhf 1:5.38-5 [113 kB]
Get:30 http://172.17.0.1/private bullseye-staging/main armhf file armhf 1:5.38-5 [67.0 kB]
Get:31 http://172.17.0.1/private bullseye-staging/main armhf gettext-base armhf 0.19.8.1-10 [117 kB]
Get:32 http://172.17.0.1/private bullseye-staging/main armhf libsigsegv2 armhf 2.12-2 [32.3 kB]
Get:33 http://172.17.0.1/private bullseye-staging/main armhf m4 armhf 1.4.18-4 [185 kB]
Get:34 http://172.17.0.1/private bullseye-staging/main armhf autoconf all 2.69-11.1 [341 kB]
Get:35 http://172.17.0.1/private bullseye-staging/main armhf autotools-dev all 20180224.1 [77.0 kB]
Get:36 http://172.17.0.1/private bullseye-staging/main armhf automake all 1:1.16.2-3 [801 kB]
Get:37 http://172.17.0.1/private bullseye-staging/main armhf autopoint all 0.19.8.1-10 [435 kB]
Get:38 http://172.17.0.1/private bullseye-staging/main armhf bwa armhf 0.7.17-5+b2 [200 kB]
Get:39 http://172.17.0.1/private bullseye-staging/main armhf libtool all 2.4.6-14 [513 kB]
Get:40 http://172.17.0.1/private bullseye-staging/main armhf dh-autoreconf all 19 [16.9 kB]
Get:41 http://172.17.0.1/private bullseye-staging/main armhf libdebhelper-perl all 13.2 [187 kB]
Get:42 http://172.17.0.1/private bullseye-staging/main armhf libarchive-zip-perl all 1.68-1 [104 kB]
Get:43 http://172.17.0.1/private bullseye-staging/main armhf libsub-override-perl all 0.09-2 [10.2 kB]
Get:44 http://172.17.0.1/private bullseye-staging/main armhf libfile-stripnondeterminism-perl all 1.9.0-1 [25.5 kB]
Get:45 http://172.17.0.1/private bullseye-staging/main armhf dh-strip-nondeterminism all 1.9.0-1 [15.2 kB]
Get:46 http://172.17.0.1/private bullseye-staging/main armhf libelf1 armhf 0.180-1 [162 kB]
Get:47 http://172.17.0.1/private bullseye-staging/main armhf dwz armhf 0.13-5 [142 kB]
Get:48 http://172.17.0.1/private bullseye-staging/main armhf libglib2.0-0 armhf 2.64.4-1 [1159 kB]
Get:49 http://172.17.0.1/private bullseye-staging/main armhf libicu67 armhf 67.1-4 [8289 kB]
Get:50 http://172.17.0.1/private bullseye-staging/main armhf libxml2 armhf 2.9.10+dfsg-5+b1 [593 kB]
Get:51 http://172.17.0.1/private bullseye-staging/main armhf libcroco3 armhf 0.6.13-1 [133 kB]
Get:52 http://172.17.0.1/private bullseye-staging/main armhf gettext armhf 0.19.8.1-10 [1219 kB]
Get:53 http://172.17.0.1/private bullseye-staging/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB]
Get:54 http://172.17.0.1/private bullseye-staging/main armhf po-debconf all 1.0.21 [248 kB]
Get:55 http://172.17.0.1/private bullseye-staging/main armhf debhelper all 13.2 [1007 kB]
Get:56 http://172.17.0.1/private bullseye-staging/main armhf python3-lib2to3 all 3.8.5-1 [78.4 kB]
Get:57 http://172.17.0.1/private bullseye-staging/main armhf python3-distutils all 3.8.5-1 [145 kB]
Get:58 http://172.17.0.1/private bullseye-staging/main armhf dh-python all 4.20200315 [91.6 kB]
Get:59 http://172.17.0.1/private bullseye-staging/main armhf fonts-lyx all 2.3.5.2-1 [200 kB]
Get:60 http://172.17.0.1/private bullseye-staging/main armhf libblas3 armhf 3.9.0-3 [108 kB]
Get:61 http://172.17.0.1/private bullseye-staging/main armhf libbrotli1 armhf 1.0.7-7 [258 kB]
Get:62 http://172.17.0.1/private bullseye-staging/main armhf libbsd0 armhf 0.10.0-1 [112 kB]
Get:63 http://172.17.0.1/private bullseye-staging/main armhf libexpat1-dev armhf 2.2.9-1 [119 kB]
Get:64 http://172.17.0.1/private bullseye-staging/main armhf libpng16-16 armhf 1.6.37-2 [274 kB]
Get:65 http://172.17.0.1/private bullseye-staging/main armhf libfreetype6 armhf 2.10.2+dfsg-3 [347 kB]
Get:66 http://172.17.0.1/private bullseye-staging/main armhf libgfortran5 armhf 10.2.0-5+rpi1 [231 kB]
Get:67 http://172.17.0.1/private bullseye-staging/main armhf libimagequant0 armhf 2.12.2-1.1 [27.2 kB]
Get:68 http://172.17.0.1/private bullseye-staging/main armhf libjbig0 armhf 2.1-3.1+b2 [27.6 kB]
Get:69 http://172.17.0.1/private bullseye-staging/main armhf libjpeg62-turbo armhf 1:2.0.5-1.1 [121 kB]
Get:70 http://172.17.0.1/private bullseye-staging/main armhf node-jquery all 3.5.1+dfsg-4 [309 kB]
Get:71 http://172.17.0.1/private bullseye-staging/main armhf libjs-jquery all 3.5.1+dfsg-4 [3612 B]
Get:72 http://172.17.0.1/private bullseye-staging/main armhf libjs-jquery-ui all 1.12.1+dfsg-5 [232 kB]
Get:73 http://172.17.0.1/private bullseye-staging/main armhf liblapack3 armhf 3.9.0-3 [1597 kB]
Get:74 http://172.17.0.1/private bullseye-staging/main armhf liblbfgsb0 armhf 3.0+dfsg.3-9 [24.6 kB]
Get:75 http://172.17.0.1/private bullseye-staging/main armhf liblcms2-2 armhf 2.9-4 [119 kB]
Get:76 http://172.17.0.1/private bullseye-staging/main armhf libpython3.8 armhf 3.8.5-2 [1363 kB]
Get:77 http://172.17.0.1/private bullseye-staging/main armhf libpython3.8-dev armhf 3.8.5-2 [3053 kB]
Get:78 http://172.17.0.1/private bullseye-staging/main armhf libpython3-dev armhf 3.8.2-3 [21.0 kB]
Get:79 http://172.17.0.1/private bullseye-staging/main armhf libwebp6 armhf 0.6.1-2 [228 kB]
Get:80 http://172.17.0.1/private bullseye-staging/main armhf libtiff5 armhf 4.1.0+git191117-2 [250 kB]
Get:81 http://172.17.0.1/private bullseye-staging/main armhf libwebpdemux2 armhf 0.6.1-2 [86.7 kB]
Get:82 http://172.17.0.1/private bullseye-staging/main armhf libwebpmux3 armhf 0.6.1-2 [94.2 kB]
Get:83 http://172.17.0.1/private bullseye-staging/main armhf libxau6 armhf 1:1.0.8-1+b2 [19.1 kB]
Get:84 http://172.17.0.1/private bullseye-staging/main armhf libxdmcp6 armhf 1:1.1.2-3 [25.0 kB]
Get:85 http://172.17.0.1/private bullseye-staging/main armhf libxcb1 armhf 1.14-2 [135 kB]
Get:86 http://172.17.0.1/private bullseye-staging/main armhf ttf-bitstream-vera all 1.10-8 [352 kB]
Get:87 http://172.17.0.1/private bullseye-staging/main armhf python-matplotlib-data all 3.2.2-1 [4146 kB]
Get:88 http://172.17.0.1/private bullseye-staging/main armhf python3-six all 1.15.0-1 [16.8 kB]
Get:89 http://172.17.0.1/private bullseye-staging/main armhf python3-cycler all 0.10.0-3 [8084 B]
Get:90 http://172.17.0.1/private bullseye-staging/main armhf python3-dateutil all 2.8.1-4 [81.6 kB]
Get:91 http://172.17.0.1/private bullseye-staging/main armhf python3-decorator all 4.4.2-2 [15.8 kB]
Get:92 http://172.17.0.1/private bullseye-staging/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-2 [184 kB]
Get:93 http://172.17.0.1/private bullseye-staging/main armhf python3.8-dev armhf 3.8.5-2 [515 kB]
Get:94 http://172.17.0.1/private bullseye-staging/main armhf python3-dev armhf 3.8.2-3 [1164 B]
Get:95 http://172.17.0.1/private bullseye-staging/main armhf python3-pkg-resources all 46.1.3-1 [183 kB]
Get:96 http://172.17.0.1/private bullseye-staging/main armhf python3-kiwisolver armhf 1.0.1-3 [245 kB]
Get:97 http://172.17.0.1/private bullseye-staging/main armhf python3-pyparsing all 2.4.7-1 [109 kB]
Get:98 http://172.17.0.1/private bullseye-staging/main armhf python3-numpy armhf 1:1.18.4-1 [3037 kB]
Get:99 http://172.17.0.1/private bullseye-staging/main armhf python3-matplotlib armhf 3.2.2-1 [4620 kB]
Get:100 http://172.17.0.1/private bullseye-staging/main armhf python3-tz all 2020.1-2 [34.6 kB]
Get:101 http://172.17.0.1/private bullseye-staging/main armhf python3-pandas-lib armhf 0.25.3+dfsg2-5+rpi1 [2956 kB]
Get:102 http://172.17.0.1/private bullseye-staging/main armhf python3-pandas all 0.25.3+dfsg2-5+rpi1 [1984 kB]
Get:103 http://172.17.0.1/private bullseye-staging/main armhf python3-patsy all 0.5.1-2 [172 kB]
Get:104 http://172.17.0.1/private bullseye-staging/main armhf python3-pil armhf 7.2.0-1 [401 kB]
Get:105 http://172.17.0.1/private bullseye-staging/main armhf python3-pubsub all 4.0.3-4 [46.6 kB]
Get:106 http://172.17.0.1/private bullseye-staging/main armhf python3-scipy armhf 1.4.1-2 [10.4 MB]
Get:107 http://172.17.0.1/private bullseye-staging/main armhf python3-setuptools all 46.1.3-1 [382 kB]
Get:108 http://172.17.0.1/private bullseye-staging/main armhf python3-statsmodels-lib armhf 0.11.1-3+rpi1 [1229 kB]
Get:109 http://172.17.0.1/private bullseye-staging/main armhf python3-statsmodels all 0.11.1-3+rpi1 [3959 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 97.0 MB in 8s (12.5 MB/s)
(Reading database ... 12517 files and directories currently installed.)
Preparing to unpack .../libcc1-0_10.2.0-5+rpi1_armhf.deb ...
Unpacking libcc1-0:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../gcc-10-base_10.2.0-5+rpi1_armhf.deb ...
Unpacking gcc-10-base:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Setting up gcc-10-base:armhf (10.2.0-5+rpi1) ...
(Reading database ... 12517 files and directories currently installed.)
Preparing to unpack .../libgcc-s1_10.2.0-5+rpi1_armhf.deb ...
Unpacking libgcc-s1:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Setting up libgcc-s1:armhf (10.2.0-5+rpi1) ...
(Reading database ... 12517 files and directories currently installed.)
Preparing to unpack .../0-libgomp1_10.2.0-5+rpi1_armhf.deb ...
Unpacking libgomp1:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../1-libatomic1_10.2.0-5+rpi1_armhf.deb ...
Unpacking libatomic1:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../2-libasan6_10.2.0-5+rpi1_armhf.deb ...
Unpacking libasan6:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../3-libubsan1_10.2.0-5+rpi1_armhf.deb ...
Unpacking libubsan1:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../4-g++-10_10.2.0-5+rpi1_armhf.deb ...
Unpacking g++-10 (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../5-libstdc++-10-dev_10.2.0-5+rpi1_armhf.deb ...
Unpacking libstdc++-10-dev:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../6-libgcc-10-dev_10.2.0-5+rpi1_armhf.deb ...
Unpacking libgcc-10-dev:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../7-gcc-10_10.2.0-5+rpi1_armhf.deb ...
Unpacking gcc-10 (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../8-cpp-10_10.2.0-5+rpi1_armhf.deb ...
Unpacking cpp-10 (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Preparing to unpack .../9-libstdc++6_10.2.0-5+rpi1_armhf.deb ...
Unpacking libstdc++6:armhf (10.2.0-5+rpi1) over (10.1.0-6+rpi1) ...
Setting up libstdc++6:armhf (10.2.0-5+rpi1) ...
Selecting previously unselected package libuchardet0:armhf.
(Reading database ... 12517 files and directories currently installed.)
Preparing to unpack .../0-libuchardet0_0.0.7-1_armhf.deb ...
Unpacking libuchardet0:armhf (0.0.7-1) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../1-groff-base_1.22.4-5_armhf.deb ...
Unpacking groff-base (1.22.4-5) ...
Selecting previously unselected package libpipeline1:armhf.
Preparing to unpack .../2-libpipeline1_1.5.3-1_armhf.deb ...
Unpacking libpipeline1:armhf (1.5.3-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../3-man-db_2.9.3-2_armhf.deb ...
Unpacking man-db (2.9.3-2) ...
Selecting previously unselected package libssl1.1:armhf.
Preparing to unpack .../4-libssl1.1_1.1.1g-1_armhf.deb ...
Unpacking libssl1.1:armhf (1.1.1g-1) ...
Selecting previously unselected package libpython3.8-minimal:armhf.
Preparing to unpack .../5-libpython3.8-minimal_3.8.5-2_armhf.deb ...
Unpacking libpython3.8-minimal:armhf (3.8.5-2) ...
Selecting previously unselected package libexpat1:armhf.
Preparing to unpack .../6-libexpat1_2.2.9-1_armhf.deb ...
Unpacking libexpat1:armhf (2.2.9-1) ...
Selecting previously unselected package python3.8-minimal.
Preparing to unpack .../7-python3.8-minimal_3.8.5-2_armhf.deb ...
Unpacking python3.8-minimal (3.8.5-2) ...
Setting up libssl1.1:armhf (1.1.1g-1) ...
Setting up libpython3.8-minimal:armhf (3.8.5-2) ...
Setting up libexpat1:armhf (2.2.9-1) ...
Setting up python3.8-minimal (3.8.5-2) ...
Selecting previously unselected package python3-minimal.
(Reading database ... 13346 files and directories currently installed.)
Preparing to unpack .../python3-minimal_3.8.2-3_armhf.deb ...
Unpacking python3-minimal (3.8.2-3) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../mime-support_3.64_all.deb ...
Unpacking mime-support (3.64) ...
Selecting previously unselected package libpython3.8-stdlib:armhf.
Preparing to unpack .../libpython3.8-stdlib_3.8.5-2_armhf.deb ...
Unpacking libpython3.8-stdlib:armhf (3.8.5-2) ...
Selecting previously unselected package python3.8.
Preparing to unpack .../python3.8_3.8.5-2_armhf.deb ...
Unpacking python3.8 (3.8.5-2) ...
Selecting previously unselected package libpython3-stdlib:armhf.
Preparing to unpack .../libpython3-stdlib_3.8.2-3_armhf.deb ...
Unpacking libpython3-stdlib:armhf (3.8.2-3) ...
Setting up python3-minimal (3.8.2-3) ...
Selecting previously unselected package python3.
(Reading database ... 13742 files and directories currently installed.)
Preparing to unpack .../00-python3_3.8.2-3_armhf.deb ...
Unpacking python3 (3.8.2-3) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../01-libmagic-mgc_1%3a5.38-5_armhf.deb ...
Unpacking libmagic-mgc (1:5.38-5) ...
Selecting previously unselected package libmagic1:armhf.
Preparing to unpack .../02-libmagic1_1%3a5.38-5_armhf.deb ...
Unpacking libmagic1:armhf (1:5.38-5) ...
Selecting previously unselected package file.
Preparing to unpack .../03-file_1%3a5.38-5_armhf.deb ...
Unpacking file (1:5.38-5) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../04-gettext-base_0.19.8.1-10_armhf.deb ...
Unpacking gettext-base (0.19.8.1-10) ...
Selecting previously unselected package libsigsegv2:armhf.
Preparing to unpack .../05-libsigsegv2_2.12-2_armhf.deb ...
Unpacking libsigsegv2:armhf (2.12-2) ...
Selecting previously unselected package m4.
Preparing to unpack .../06-m4_1.4.18-4_armhf.deb ...
Unpacking m4 (1.4.18-4) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../07-autoconf_2.69-11.1_all.deb ...
Unpacking autoconf (2.69-11.1) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../08-autotools-dev_20180224.1_all.deb ...
Unpacking autotools-dev (20180224.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../09-automake_1%3a1.16.2-3_all.deb ...
Unpacking automake (1:1.16.2-3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../10-autopoint_0.19.8.1-10_all.deb ...
Unpacking autopoint (0.19.8.1-10) ...
Selecting previously unselected package bwa.
Preparing to unpack .../11-bwa_0.7.17-5+b2_armhf.deb ...
Unpacking bwa (0.7.17-5+b2) ...
Selecting previously unselected package libtool.
Preparing to unpack .../12-libtool_2.4.6-14_all.deb ...
Unpacking libtool (2.4.6-14) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../13-dh-autoreconf_19_all.deb ...
Unpacking dh-autoreconf (19) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../14-libdebhelper-perl_13.2_all.deb ...
Unpacking libdebhelper-perl (13.2) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libsub-override-perl.
Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ...
Unpacking libsub-override-perl (0.09-2) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.9.0-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.9.0-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../18-dh-strip-nondeterminism_1.9.0-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.9.0-1) ...
Selecting previously unselected package libelf1:armhf.
Preparing to unpack .../19-libelf1_0.180-1_armhf.deb ...
Unpacking libelf1:armhf (0.180-1) ...
Selecting previously unselected package dwz.
Preparing to unpack .../20-dwz_0.13-5_armhf.deb ...
Unpacking dwz (0.13-5) ...
Selecting previously unselected package libglib2.0-0:armhf.
Preparing to unpack .../21-libglib2.0-0_2.64.4-1_armhf.deb ...
Unpacking libglib2.0-0:armhf (2.64.4-1) ...
Selecting previously unselected package libicu67:armhf.
Preparing to unpack .../22-libicu67_67.1-4_armhf.deb ...
Unpacking libicu67:armhf (67.1-4) ...
Selecting previously unselected package libxml2:armhf.
Preparing to unpack .../23-libxml2_2.9.10+dfsg-5+b1_armhf.deb ...
Unpacking libxml2:armhf (2.9.10+dfsg-5+b1) ...
Selecting previously unselected package libcroco3:armhf.
Preparing to unpack .../24-libcroco3_0.6.13-1_armhf.deb ...
Unpacking libcroco3:armhf (0.6.13-1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../25-gettext_0.19.8.1-10_armhf.deb ...
Unpacking gettext (0.19.8.1-10) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../26-intltool-debian_0.35.0+20060710.5_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.5) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../27-po-debconf_1.0.21_all.deb ...
Unpacking po-debconf (1.0.21) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../28-debhelper_13.2_all.deb ...
Unpacking debhelper (13.2) ...
Selecting previously unselected package python3-lib2to3.
Preparing to unpack .../29-python3-lib2to3_3.8.5-1_all.deb ...
Unpacking python3-lib2to3 (3.8.5-1) ...
Selecting previously unselected package python3-distutils.
Preparing to unpack .../30-python3-distutils_3.8.5-1_all.deb ...
Unpacking python3-distutils (3.8.5-1) ...
Selecting previously unselected package dh-python.
Preparing to unpack .../31-dh-python_4.20200315_all.deb ...
Unpacking dh-python (4.20200315) ...
Selecting previously unselected package fonts-lyx.
Preparing to unpack .../32-fonts-lyx_2.3.5.2-1_all.deb ...
Unpacking fonts-lyx (2.3.5.2-1) ...
Selecting previously unselected package libblas3:armhf.
Preparing to unpack .../33-libblas3_3.9.0-3_armhf.deb ...
Unpacking libblas3:armhf (3.9.0-3) ...
Selecting previously unselected package libbrotli1:armhf.
Preparing to unpack .../34-libbrotli1_1.0.7-7_armhf.deb ...
Unpacking libbrotli1:armhf (1.0.7-7) ...
Selecting previously unselected package libbsd0:armhf.
Preparing to unpack .../35-libbsd0_0.10.0-1_armhf.deb ...
Unpacking libbsd0:armhf (0.10.0-1) ...
Selecting previously unselected package libexpat1-dev:armhf.
Preparing to unpack .../36-libexpat1-dev_2.2.9-1_armhf.deb ...
Unpacking libexpat1-dev:armhf (2.2.9-1) ...
Selecting previously unselected package libpng16-16:armhf.
Preparing to unpack .../37-libpng16-16_1.6.37-2_armhf.deb ...
Unpacking libpng16-16:armhf (1.6.37-2) ...
Selecting previously unselected package libfreetype6:armhf.
Preparing to unpack .../38-libfreetype6_2.10.2+dfsg-3_armhf.deb ...
Unpacking libfreetype6:armhf (2.10.2+dfsg-3) ...
Selecting previously unselected package libgfortran5:armhf.
Preparing to unpack .../39-libgfortran5_10.2.0-5+rpi1_armhf.deb ...
Unpacking libgfortran5:armhf (10.2.0-5+rpi1) ...
Selecting previously unselected package libimagequant0:armhf.
Preparing to unpack .../40-libimagequant0_2.12.2-1.1_armhf.deb ...
Unpacking libimagequant0:armhf (2.12.2-1.1) ...
Selecting previously unselected package libjbig0:armhf.
Preparing to unpack .../41-libjbig0_2.1-3.1+b2_armhf.deb ...
Unpacking libjbig0:armhf (2.1-3.1+b2) ...
Selecting previously unselected package libjpeg62-turbo:armhf.
Preparing to unpack .../42-libjpeg62-turbo_1%3a2.0.5-1.1_armhf.deb ...
Unpacking libjpeg62-turbo:armhf (1:2.0.5-1.1) ...
Selecting previously unselected package node-jquery.
Preparing to unpack .../43-node-jquery_3.5.1+dfsg-4_all.deb ...
Unpacking node-jquery (3.5.1+dfsg-4) ...
Selecting previously unselected package libjs-jquery.
Preparing to unpack .../44-libjs-jquery_3.5.1+dfsg-4_all.deb ...
Unpacking libjs-jquery (3.5.1+dfsg-4) ...
Selecting previously unselected package libjs-jquery-ui.
Preparing to unpack .../45-libjs-jquery-ui_1.12.1+dfsg-5_all.deb ...
Unpacking libjs-jquery-ui (1.12.1+dfsg-5) ...
Selecting previously unselected package liblapack3:armhf.
Preparing to unpack .../46-liblapack3_3.9.0-3_armhf.deb ...
Unpacking liblapack3:armhf (3.9.0-3) ...
Selecting previously unselected package liblbfgsb0:armhf.
Preparing to unpack .../47-liblbfgsb0_3.0+dfsg.3-9_armhf.deb ...
Unpacking liblbfgsb0:armhf (3.0+dfsg.3-9) ...
Selecting previously unselected package liblcms2-2:armhf.
Preparing to unpack .../48-liblcms2-2_2.9-4_armhf.deb ...
Unpacking liblcms2-2:armhf (2.9-4) ...
Selecting previously unselected package libpython3.8:armhf.
Preparing to unpack .../49-libpython3.8_3.8.5-2_armhf.deb ...
Unpacking libpython3.8:armhf (3.8.5-2) ...
Selecting previously unselected package libpython3.8-dev:armhf.
Preparing to unpack .../50-libpython3.8-dev_3.8.5-2_armhf.deb ...
Unpacking libpython3.8-dev:armhf (3.8.5-2) ...
Selecting previously unselected package libpython3-dev:armhf.
Preparing to unpack .../51-libpython3-dev_3.8.2-3_armhf.deb ...
Unpacking libpython3-dev:armhf (3.8.2-3) ...
Selecting previously unselected package libwebp6:armhf.
Preparing to unpack .../52-libwebp6_0.6.1-2_armhf.deb ...
Unpacking libwebp6:armhf (0.6.1-2) ...
Selecting previously unselected package libtiff5:armhf.
Preparing to unpack .../53-libtiff5_4.1.0+git191117-2_armhf.deb ...
Unpacking libtiff5:armhf (4.1.0+git191117-2) ...
Selecting previously unselected package libwebpdemux2:armhf.
Preparing to unpack .../54-libwebpdemux2_0.6.1-2_armhf.deb ...
Unpacking libwebpdemux2:armhf (0.6.1-2) ...
Selecting previously unselected package libwebpmux3:armhf.
Preparing to unpack .../55-libwebpmux3_0.6.1-2_armhf.deb ...
Unpacking libwebpmux3:armhf (0.6.1-2) ...
Selecting previously unselected package libxau6:armhf.
Preparing to unpack .../56-libxau6_1%3a1.0.8-1+b2_armhf.deb ...
Unpacking libxau6:armhf (1:1.0.8-1+b2) ...
Selecting previously unselected package libxdmcp6:armhf.
Preparing to unpack .../57-libxdmcp6_1%3a1.1.2-3_armhf.deb ...
Unpacking libxdmcp6:armhf (1:1.1.2-3) ...
Selecting previously unselected package libxcb1:armhf.
Preparing to unpack .../58-libxcb1_1.14-2_armhf.deb ...
Unpacking libxcb1:armhf (1.14-2) ...
Selecting previously unselected package ttf-bitstream-vera.
Preparing to unpack .../59-ttf-bitstream-vera_1.10-8_all.deb ...
Unpacking ttf-bitstream-vera (1.10-8) ...
Selecting previously unselected package python-matplotlib-data.
Preparing to unpack .../60-python-matplotlib-data_3.2.2-1_all.deb ...
Unpacking python-matplotlib-data (3.2.2-1) ...
Selecting previously unselected package python3-six.
Preparing to unpack .../61-python3-six_1.15.0-1_all.deb ...
Unpacking python3-six (1.15.0-1) ...
Selecting previously unselected package python3-cycler.
Preparing to unpack .../62-python3-cycler_0.10.0-3_all.deb ...
Unpacking python3-cycler (0.10.0-3) ...
Selecting previously unselected package python3-dateutil.
Preparing to unpack .../63-python3-dateutil_2.8.1-4_all.deb ...
Unpacking python3-dateutil (2.8.1-4) ...
Selecting previously unselected package python3-decorator.
Preparing to unpack .../64-python3-decorator_4.4.2-2_all.deb ...
Unpacking python3-decorator (4.4.2-2) ...
Selecting previously unselected package zlib1g-dev:armhf.
Preparing to unpack .../65-zlib1g-dev_1%3a1.2.11.dfsg-2_armhf.deb ...
Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-2) ...
Selecting previously unselected package python3.8-dev.
Preparing to unpack .../66-python3.8-dev_3.8.5-2_armhf.deb ...
Unpacking python3.8-dev (3.8.5-2) ...
Selecting previously unselected package python3-dev.
Preparing to unpack .../67-python3-dev_3.8.2-3_armhf.deb ...
Unpacking python3-dev (3.8.2-3) ...
Selecting previously unselected package python3-pkg-resources.
Preparing to unpack .../68-python3-pkg-resources_46.1.3-1_all.deb ...
Unpacking python3-pkg-resources (46.1.3-1) ...
Selecting previously unselected package python3-kiwisolver.
Preparing to unpack .../69-python3-kiwisolver_1.0.1-3_armhf.deb ...
Unpacking python3-kiwisolver (1.0.1-3) ...
Selecting previously unselected package python3-pyparsing.
Preparing to unpack .../70-python3-pyparsing_2.4.7-1_all.deb ...
Unpacking python3-pyparsing (2.4.7-1) ...
Selecting previously unselected package python3-numpy.
Preparing to unpack .../71-python3-numpy_1%3a1.18.4-1_armhf.deb ...
Unpacking python3-numpy (1:1.18.4-1) ...
Selecting previously unselected package python3-matplotlib.
Preparing to unpack .../72-python3-matplotlib_3.2.2-1_armhf.deb ...
Unpacking python3-matplotlib (3.2.2-1) ...
Selecting previously unselected package python3-tz.
Preparing to unpack .../73-python3-tz_2020.1-2_all.deb ...
Unpacking python3-tz (2020.1-2) ...
Selecting previously unselected package python3-pandas-lib.
Preparing to unpack .../74-python3-pandas-lib_0.25.3+dfsg2-5+rpi1_armhf.deb ...
Unpacking python3-pandas-lib (0.25.3+dfsg2-5+rpi1) ...
Selecting previously unselected package python3-pandas.
Preparing to unpack .../75-python3-pandas_0.25.3+dfsg2-5+rpi1_all.deb ...
Unpacking python3-pandas (0.25.3+dfsg2-5+rpi1) ...
Selecting previously unselected package python3-patsy.
Preparing to unpack .../76-python3-patsy_0.5.1-2_all.deb ...
Unpacking python3-patsy (0.5.1-2) ...
Selecting previously unselected package python3-pil:armhf.
Preparing to unpack .../77-python3-pil_7.2.0-1_armhf.deb ...
Unpacking python3-pil:armhf (7.2.0-1) ...
Selecting previously unselected package python3-pubsub.
Preparing to unpack .../78-python3-pubsub_4.0.3-4_all.deb ...
Unpacking python3-pubsub (4.0.3-4) ...
Selecting previously unselected package python3-scipy.
Preparing to unpack .../79-python3-scipy_1.4.1-2_armhf.deb ...
Unpacking python3-scipy (1.4.1-2) ...
Selecting previously unselected package python3-setuptools.
Preparing to unpack .../80-python3-setuptools_46.1.3-1_all.deb ...
Unpacking python3-setuptools (46.1.3-1) ...
Selecting previously unselected package python3-statsmodels-lib:armhf.
Preparing to unpack .../81-python3-statsmodels-lib_0.11.1-3+rpi1_armhf.deb ...
Unpacking python3-statsmodels-lib:armhf (0.11.1-3+rpi1) ...
Selecting previously unselected package python3-statsmodels.
Preparing to unpack .../82-python3-statsmodels_0.11.1-3+rpi1_all.deb ...
Unpacking python3-statsmodels (0.11.1-3+rpi1) ...
Selecting previously unselected package sbuild-build-depends-tnseq-transit-dummy.
Preparing to unpack .../83-sbuild-build-depends-tnseq-transit-dummy_0.invalid.0_armhf.deb ...
Unpacking sbuild-build-depends-tnseq-transit-dummy (0.invalid.0) ...
Setting up libpipeline1:armhf (1.5.3-1) ...
Setting up liblcms2-2:armhf (2.9-4) ...
Setting up libxau6:armhf (1:1.0.8-1+b2) ...
Setting up ttf-bitstream-vera (1.10-8) ...
Setting up mime-support (3.64) ...
Setting up libicu67:armhf (67.1-4) ...
Setting up libmagic-mgc (1:5.38-5) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up libglib2.0-0:armhf (2.64.4-1) ...
No schema files found: doing nothing.
Setting up bwa (0.7.17-5+b2) ...
Setting up fonts-lyx (2.3.5.2-1) ...
Setting up libdebhelper-perl (13.2) ...
Setting up libbrotli1:armhf (1.0.7-7) ...
Setting up libmagic1:armhf (1:5.38-5) ...
Setting up gettext-base (0.19.8.1-10) ...
Setting up file (1:5.38-5) ...
Setting up libgomp1:armhf (10.2.0-5+rpi1) ...
Setting up libjbig0:armhf (2.1-3.1+b2) ...
Setting up libasan6:armhf (10.2.0-5+rpi1) ...
Setting up autotools-dev (20180224.1) ...
Setting up libblas3:armhf (3.9.0-3) ...
update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode
Setting up libexpat1-dev:armhf (2.2.9-1) ...
Setting up libjpeg62-turbo:armhf (1:2.0.5-1.1) ...
Setting up libsigsegv2:armhf (2.12-2) ...
Setting up libimagequant0:armhf (2.12.2-1.1) ...
Setting up libpng16-16:armhf (1.6.37-2) ...
Setting up libatomic1:armhf (10.2.0-5+rpi1) ...
Setting up autopoint (0.19.8.1-10) ...
Setting up libwebp6:armhf (0.6.1-2) ...
Setting up libgfortran5:armhf (10.2.0-5+rpi1) ...
Setting up libubsan1:armhf (10.2.0-5+rpi1) ...
Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-2) ...
Setting up libuchardet0:armhf (0.0.7-1) ...
Setting up libsub-override-perl (0.09-2) ...
Setting up libtiff5:armhf (4.1.0+git191117-2) ...
Setting up libpython3.8-stdlib:armhf (3.8.5-2) ...
Setting up python3.8 (3.8.5-2) ...
Setting up python-matplotlib-data (3.2.2-1) ...
Setting up libwebpmux3:armhf (0.6.1-2) ...
Setting up libbsd0:armhf (0.10.0-1) ...
Setting up libelf1:armhf (0.180-1) ...
Setting up libxml2:armhf (2.9.10+dfsg-5+b1) ...
Setting up libcc1-0:armhf (10.2.0-5+rpi1) ...
Setting up cpp-10 (10.2.0-5+rpi1) ...
Setting up node-jquery (3.5.1+dfsg-4) ...
Setting up libpython3-stdlib:armhf (3.8.2-3) ...
Setting up libfile-stripnondeterminism-perl (1.9.0-1) ...
Setting up libxdmcp6:armhf (1:1.1.2-3) ...
Setting up liblapack3:armhf (3.9.0-3) ...
update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode
Setting up libxcb1:armhf (1.14-2) ...
Setting up libtool (2.4.6-14) ...
Setting up libwebpdemux2:armhf (0.6.1-2) ...
Setting up libgcc-10-dev:armhf (10.2.0-5+rpi1) ...
Setting up m4 (1.4.18-4) ...
Setting up python3 (3.8.2-3) ...
Setting up python3-tz (2020.1-2) ...
Setting up python3-six (1.15.0-1) ...
Setting up python3-decorator (4.4.2-2) ...
Setting up python3-pyparsing (2.4.7-1) ...
Setting up libfreetype6:armhf (2.10.2+dfsg-3) ...
Setting up libpython3.8:armhf (3.8.5-2) ...
Setting up python3-cycler (0.10.0-3) ...
Setting up libcroco3:armhf (0.6.13-1) ...
Setting up gcc-10 (10.2.0-5+rpi1) ...
Setting up autoconf (2.69-11.1) ...
Setting up dh-strip-nondeterminism (1.9.0-1) ...
Setting up python3-pubsub (4.0.3-4) ...
Setting up dwz (0.13-5) ...
Setting up groff-base (1.22.4-5) ...
Setting up python3-dateutil (2.8.1-4) ...
Setting up libjs-jquery (3.5.1+dfsg-4) ...
Setting up python3-lib2to3 (3.8.5-1) ...
Setting up liblbfgsb0:armhf (3.0+dfsg.3-9) ...
Setting up python3-pkg-resources (46.1.3-1) ...
Setting up automake (1:1.16.2-3) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up python3-distutils (3.8.5-1) ...
Setting up dh-python (4.20200315) ...
Setting up gettext (0.19.8.1-10) ...
Setting up libstdc++-10-dev:armhf (10.2.0-5+rpi1) ...
Setting up g++-10 (10.2.0-5+rpi1) ...
Setting up python3-setuptools (46.1.3-1) ...
Setting up man-db (2.9.3-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up intltool-debian (0.35.0+20060710.5) ...
Setting up python3-pil:armhf (7.2.0-1) ...
Setting up libjs-jquery-ui (1.12.1+dfsg-5) ...
Setting up libpython3.8-dev:armhf (3.8.5-2) ...
Setting up python3-kiwisolver (1.0.1-3) ...
Setting up python3-numpy (1:1.18.4-1) ...
Setting up python3.8-dev (3.8.5-2) ...
Setting up python3-statsmodels-lib:armhf (0.11.1-3+rpi1) ...
Setting up python3-matplotlib (3.2.2-1) ...
Setting up python3-scipy (1.4.1-2) ...
Setting up libpython3-dev:armhf (3.8.2-3) ...
Setting up po-debconf (1.0.21) ...
Setting up python3-pandas-lib (0.25.3+dfsg2-5+rpi1) ...
Setting up python3-patsy (0.5.1-2) ...
Setting up python3-pandas (0.25.3+dfsg2-5+rpi1) ...
Setting up python3-dev (3.8.2-3) ...
Setting up python3-statsmodels (0.11.1-3+rpi1) ...
Setting up debhelper (13.2) ...
Setting up dh-autoreconf (19) ...
Setting up sbuild-build-depends-tnseq-transit-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.31-3+rpi1) ...
W: No sandbox user '_apt' on the system, can not drop privileges

+------------------------------------------------------------------------------+
| Build environment                                                            |
+------------------------------------------------------------------------------+

Kernel: Linux 4.9.0-0.bpo.2-armmp armhf (armv7l)
Toolchain package versions: binutils_2.35-1+rpi1 dpkg-dev_1.20.5+rpi1 g++-10_10.2.0-5+rpi1 gcc-10_10.2.0-5+rpi1 libc6-dev_2.31-3+rpi1 libstdc++-10-dev_10.2.0-5+rpi1 libstdc++6_10.2.0-5+rpi1 linux-libc-dev_5.7.10-1+rpi1
Package versions: adduser_3.118 apt_2.1.10 aptitude_0.8.13-1+b1 aptitude-common_0.8.13-1 autoconf_2.69-11.1 automake_1:1.16.2-3 autopoint_0.19.8.1-10 autotools-dev_20180224.1 base-files_11+rpi1 base-passwd_3.5.47 bash_5.0-7 binutils_2.35-1+rpi1 binutils-arm-linux-gnueabihf_2.35-1+rpi1 binutils-common_2.35-1+rpi1 bsdextrautils_2.36-2 bsdutils_1:2.36-2 build-essential_12.8 bwa_0.7.17-5+b2 bzip2_1.0.8-4 coreutils_8.30-3 cpp_4:10.1.0-1+rpi1 cpp-10_10.2.0-5+rpi1 dash_0.5.10.2-7 debconf_1.5.74 debhelper_13.2 debianutils_4.9.1 dh-autoreconf_19 dh-python_4.20200315 dh-strip-nondeterminism_1.9.0-1 diffutils_1:3.7-3 dirmngr_2.2.20-1 dpkg_1.20.5+rpi1 dpkg-dev_1.20.5+rpi1 dwz_0.13-5 e2fsprogs_1.45.6-1 fakeroot_1.24-1 fdisk_2.36-2 file_1:5.38-5 findutils_4.7.0-1 fonts-lyx_2.3.5.2-1 g++_4:10.1.0-1+rpi1 g++-10_10.2.0-5+rpi1 gcc_4:10.1.0-1+rpi1 gcc-10_10.2.0-5+rpi1 gcc-10-base_10.2.0-5+rpi1 gcc-6-base_6.5.0-1+rpi3 gcc-7-base_7.5.0-6+rpi1 gcc-8-base_8.4.0-4+rpi1 gettext_0.19.8.1-10 gettext-base_0.19.8.1-10 gnupg_2.2.20-1 gnupg-l10n_2.2.20-1 gnupg-utils_2.2.20-1 gpg_2.2.20-1 gpg-agent_2.2.20-1 gpg-wks-client_2.2.20-1 gpg-wks-server_2.2.20-1 gpgconf_2.2.20-1 gpgsm_2.2.20-1 gpgv_2.2.20-1 grep_3.4-1 groff-base_1.22.4-5 gzip_1.10-2 hostname_3.23 init-system-helpers_1.58 intltool-debian_0.35.0+20060710.5 libacl1_2.2.53-8 libapt-pkg6.0_2.1.10 libarchive-zip-perl_1.68-1 libasan6_10.2.0-5+rpi1 libassuan0_2.5.3-7.1 libatomic1_10.2.0-5+rpi1 libattr1_1:2.4.48-5 libaudit-common_1:2.8.5-3 libaudit1_1:2.8.5-3 libbinutils_2.35-1+rpi1 libblas3_3.9.0-3 libblkid1_2.36-2 libboost-iostreams1.71.0_1.71.0-6+b1 libbrotli1_1.0.7-7 libbsd0_0.10.0-1 libbz2-1.0_1.0.8-4 libc-bin_2.31-3+rpi1 libc-dev-bin_2.31-3+rpi1 libc6_2.31-3+rpi1 libc6-dev_2.31-3+rpi1 libcap-ng0_0.7.9-2.2 libcc1-0_10.2.0-5+rpi1 libcom-err2_1.45.6-1 libcroco3_0.6.13-1 libcrypt-dev_1:4.4.16-1 libcrypt1_1:4.4.16-1 libctf-nobfd0_2.35-1+rpi1 libctf0_2.35-1+rpi1 libcwidget4_0.5.18-5 libdb5.3_5.3.28+dfsg1-0.6 libdebconfclient0_0.253 libdebhelper-perl_13.2 libdpkg-perl_1.20.5+rpi1 libelf1_0.180-1 libexpat1_2.2.9-1 libexpat1-dev_2.2.9-1 libext2fs2_1.45.6-1 libfakeroot_1.24-1 libfdisk1_2.36-2 libffi7_3.3-4 libfile-stripnondeterminism-perl_1.9.0-1 libfreetype6_2.10.2+dfsg-3 libgcc-10-dev_10.2.0-5+rpi1 libgcc-s1_10.2.0-5+rpi1 libgcrypt20_1.8.6-2 libgdbm-compat4_1.18.1-5 libgdbm6_1.18.1-5 libgfortran5_10.2.0-5+rpi1 libglib2.0-0_2.64.4-1 libgmp10_2:6.2.0+dfsg-6 libgnutls30_3.6.14-2+b1 libgomp1_10.2.0-5+rpi1 libgpg-error0_1.38-2 libhogweed6_3.6-2 libicu67_67.1-4 libidn2-0_2.3.0-1 libimagequant0_2.12.2-1.1 libisl22_0.22.1-1 libjbig0_2.1-3.1+b2 libjpeg62-turbo_1:2.0.5-1.1 libjs-jquery_3.5.1+dfsg-4 libjs-jquery-ui_1.12.1+dfsg-5 libksba8_1.4.0-2 liblapack3_3.9.0-3 liblbfgsb0_3.0+dfsg.3-9 liblcms2-2_2.9-4 libldap-2.4-2_2.4.50+dfsg-1+b1 libldap-common_2.4.50+dfsg-1 liblocale-gettext-perl_1.07-4 liblz4-1_1.9.2-2 liblzma5_5.2.4-1 libmagic-mgc_1:5.38-5 libmagic1_1:5.38-5 libmount1_2.36-2 libmpc3_1.1.0-1 libmpfr6_4.0.2-1 libncursesw6_6.2-1 libnettle8_3.6-2 libnpth0_1.6-2 libp11-kit0_0.23.20-1 libpam-modules_1.3.1-5 libpam-modules-bin_1.3.1-5 libpam-runtime_1.3.1-5 libpam0g_1.3.1-5 libpcre2-8-0_10.34-7 libpcre3_2:8.39-13 libperl5.30_5.30.3-4 libpipeline1_1.5.3-1 libpng16-16_1.6.37-2 libpython3-dev_3.8.2-3 libpython3-stdlib_3.8.2-3 libpython3.8_3.8.5-2 libpython3.8-dev_3.8.5-2 libpython3.8-minimal_3.8.5-2 libpython3.8-stdlib_3.8.5-2 libreadline8_8.0-4 libsasl2-2_2.1.27+dfsg-2 libsasl2-modules-db_2.1.27+dfsg-2 libseccomp2_2.4.3-1+rpi1 libselinux1_3.1-2 libsemanage-common_3.1-1 libsemanage1_3.1-1 libsepol1_3.1-1 libsigc++-2.0-0v5_2.10.2-1 libsigsegv2_2.12-2 libsmartcols1_2.36-2 libsqlite3-0_3.32.3-1 libss2_1.45.6-1 libssl1.1_1.1.1g-1 libstdc++-10-dev_10.2.0-5+rpi1 libstdc++6_10.2.0-5+rpi1 libsub-override-perl_0.09-2 libsystemd0_245.6-2+rpi1+b1 libtasn1-6_4.16.0-2 libtext-charwidth-perl_0.04-10 libtext-iconv-perl_1.7-7 libtiff5_4.1.0+git191117-2 libtinfo6_6.2-1 libtool_2.4.6-14 libubsan1_10.2.0-5+rpi1 libuchardet0_0.0.7-1 libudev1_245.6-2+rpi1+b1 libunistring2_0.9.10-4 libuuid1_2.36-2 libwebp6_0.6.1-2 libwebpdemux2_0.6.1-2 libwebpmux3_0.6.1-2 libxapian30_1.4.15-1 libxau6_1:1.0.8-1+b2 libxcb1_1.14-2 libxdmcp6_1:1.1.2-3 libxml2_2.9.10+dfsg-5+b1 libzstd1_1.4.5+dfsg-4+rpi1 linux-libc-dev_5.7.10-1+rpi1 login_1:4.8.1-1 logsave_1.45.6-1 lsb-base_11.1.0+rpi1 m4_1.4.18-4 make_4.3-4 man-db_2.9.3-2 mawk_1.3.4.20200120-2 mime-support_3.64 mount_2.36-2 ncurses-base_6.2-1 ncurses-bin_6.2-1 netbase_6.1 node-jquery_3.5.1+dfsg-4 passwd_1:4.8.1-1 patch_2.7.6-6 perl_5.30.3-4 perl-base_5.30.3-4 perl-modules-5.30_5.30.3-4 pinentry-curses_1.1.0-4 po-debconf_1.0.21 python-matplotlib-data_3.2.2-1 python3_3.8.2-3 python3-cycler_0.10.0-3 python3-dateutil_2.8.1-4 python3-decorator_4.4.2-2 python3-dev_3.8.2-3 python3-distutils_3.8.5-1 python3-kiwisolver_1.0.1-3 python3-lib2to3_3.8.5-1 python3-matplotlib_3.2.2-1 python3-minimal_3.8.2-3 python3-numpy_1:1.18.4-1 python3-pandas_0.25.3+dfsg2-5+rpi1 python3-pandas-lib_0.25.3+dfsg2-5+rpi1 python3-patsy_0.5.1-2 python3-pil_7.2.0-1 python3-pkg-resources_46.1.3-1 python3-pubsub_4.0.3-4 python3-pyparsing_2.4.7-1 python3-scipy_1.4.1-2 python3-setuptools_46.1.3-1 python3-six_1.15.0-1 python3-statsmodels_0.11.1-3+rpi1 python3-statsmodels-lib_0.11.1-3+rpi1 python3-tz_2020.1-2 python3.8_3.8.5-2 python3.8-dev_3.8.5-2 python3.8-minimal_3.8.5-2 raspbian-archive-keyring_20120528.2 readline-common_8.0-4 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-tnseq-transit-dummy_0.invalid.0 sed_4.7-1 sensible-utils_0.0.12+nmu1 sysvinit-utils_2.96-3 tar_1.30+dfsg-7 ttf-bitstream-vera_1.10-8 tzdata_2020a-1 util-linux_2.36-2 xz-utils_5.2.4-1 zlib1g_1:1.2.11.dfsg-2 zlib1g-dev_1:1.2.11.dfsg-2

+------------------------------------------------------------------------------+
| Build                                                                        |
+------------------------------------------------------------------------------+


Unpack source
-------------

gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/tmp/dpkg-verify-sig.hunZD7Ea/trustedkeys.kbx': General error
gpgv: Signature made Tue Aug 25 14:45:20 2020 UTC
gpgv:                using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1
gpgv:                issuer "npatra974@gmail.com"
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./tnseq-transit_3.1.0-2.dsc
dpkg-source: info: extracting tnseq-transit in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking tnseq-transit_3.1.0.orig.tar.gz
dpkg-source: info: unpacking tnseq-transit_3.1.0-2.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying skip_test_requiring_non_existing_input_data.patch

Check disc space
----------------

Sufficient free space for build

User Environment
----------------

APT_CONFIG=/var/lib/sbuild/apt.conf
DEB_BUILD_OPTIONS=parallel=4
HOME=/sbuild-nonexistent
LC_ALL=POSIX
LOGNAME=buildd
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=bullseye-staging-armhf-sbuild
SCHROOT_CHROOT_NAME=bullseye-staging-armhf-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=109
SCHROOT_GROUP=buildd
SCHROOT_SESSION_ID=bullseye-staging-armhf-sbuild-8773090d-7e2e-4118-b4cd-b52042719dda
SCHROOT_UID=104
SCHROOT_USER=buildd
SHELL=/bin/sh
TERM=linux
USER=buildd

dpkg-buildpackage
-----------------

dpkg-buildpackage: info: source package tnseq-transit
dpkg-buildpackage: info: source version 3.1.0-2
dpkg-buildpackage: info: source distribution unstable
 dpkg-source --before-build .
dpkg-buildpackage: info: host architecture armhf
 debian/rules clean
dh clean --with python3 --buildsystem=pybuild
   debian/rules override_dh_auto_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_clean
I: pybuild base:217: python3.8 setup.py clean 
running clean
removing '/<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build' (and everything under it)
'build/bdist.linux-armhf' does not exist -- can't clean it
'build/scripts-3.8' does not exist -- can't clean it
rm -rf tests_invalid_data
rm -rf tnseq_transit.egg-info
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_autoreconf_clean -O--buildsystem=pybuild
   dh_clean -O--buildsystem=pybuild
 debian/rules binary-arch
dh binary-arch --with python3 --buildsystem=pybuild
   dh_update_autotools_config -a -O--buildsystem=pybuild
   dh_autoreconf -a -O--buildsystem=pybuild
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<<PKGBUILDDIR>>'
mkdir -p tests_invalid_data
mv tests/H37Rv.fna tests_invalid_data
dh_auto_configure
I: pybuild base:217: python3.8 setup.py config 
running config
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
   dh_auto_build -a -O--buildsystem=pybuild
I: pybuild base:217: /usr/bin/python3 setup.py build 
running build
running build_py
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytpp
copying src/pytpp/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytpp
copying src/pytpp/__main__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytpp
copying src/pytpp/tpp_gui.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytpp
copying src/pytpp/tpp_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytpp
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/__main__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/draw_trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/fileDisplay.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/images.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/norm_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/qcDisplay.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/stat_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/tnseq_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/transit_gui.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/transit_tools.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
copying src/pytransit/view_trash.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/anova.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/binomial.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/corrplot.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/example.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/gi.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/griffin.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/gumbel.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/heatmap.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/hmm.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/norm.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/normalize.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/pathway_enrichment.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/rankproduct.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/resampling.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/tn5gaps.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/tnseq_stats.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/utest.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
copying src/pytransit/analysis/zinb.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/analysis
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/convert
copying src/pytransit/convert/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/convert
copying src/pytransit/convert/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/convert
copying src/pytransit/convert/gff_to_prot_table.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/convert
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/__init__.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/base.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/combined_wig.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/igv.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/mean_counts.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
copying src/pytransit/export/prot_table.py -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/export
running egg_info
creating tnseq_transit.egg-info
writing tnseq_transit.egg-info/PKG-INFO
writing dependency_links to tnseq_transit.egg-info/dependency_links.txt
writing entry points to tnseq_transit.egg-info/entry_points.txt
writing requirements to tnseq_transit.egg-info/requires.txt
writing top-level names to tnseq_transit.egg-info/top_level.txt
writing manifest file 'tnseq_transit.egg-info/SOURCES.txt'
reading manifest file 'tnseq_transit.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
warning: no files found matching 'VERSION'
warning: no files found matching '*.html' under directory 'src/pytransit/doc/build/html'
warning: no files found matching '*.png' under directory 'src/pytransit/doc/build/html/_images'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_modules'
warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_static'
writing manifest file 'tnseq_transit.egg-info/SOURCES.txt'
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/COG_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/GO_associated_Rvs-3-11-18.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/GO_associated_Rvs.csv -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/GO_term_names.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/H37Rv.sanger_associated_RVS.csv -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/H37Rv_COG_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/H37Rv_GO_terms.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/H37Rv_sanger_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/cholesterol_H37Rv_rep3.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/cholesterol_glycerol_combined.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_merged.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_rep1.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/glycerol_H37Rv_rep2.wig -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg_covar.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/samples_metadata_cg_interactions.txt -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
copying src/pytransit/data/sanger_roles.dat -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/data
creating /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/BCG.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/BCG.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37Rv.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37Rv.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37RvBD_mod3.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37RvMA2.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/H37RvMA2.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/genomes.html -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/mc2_155_tamu.fna -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
copying src/pytransit/genomes/mc2_155_tamu.prot_table -> /<<PKGBUILDDIR>>/.pybuild/cpython3_3.8/build/pytransit/genomes
   debian/rules override_dh_auto_test
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_test -- --system=custom --test-args="PYTHONPATH=tests {interpreter} -m unittest -v tests/*.py"
I: pybuild base:217: PYTHONPATH=tests python3.8 -m unittest -v tests/*.py
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:648: SyntaxWarning: "is" with a literal. Did you mean "=="?
  if vars.num_replicons is 1:
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:651: SyntaxWarning: "is" with a literal. Did you mean "=="?
  elif len(vars.replicon_ids) is 1 and vars.replicon_ids[0].strip() == 'auto':
test_Binomial (tests.test_analysis_methods.TestMethods) ... 

####################
tests.test_analysis_methods.TestMethods.test_Binomial
####################
[binomial] Starting Binomial Method
[binomial] Getting Data
[binomial] Setting Parameters
[binomial] Setting Initial Values
[binomial] Running Binomial Method...   0.2%   
[binomial] Running Binomial Method...   0.3%   
[binomial] Running Binomial Method...   0.4%   
[binomial] Running Binomial Method...   0.5%   
[binomial] Running Binomial Method...   0.5%   
[binomial] Running Binomial Method...   0.6%   
[binomial] Running Binomial Method...   0.7%   
[binomial] Running Binomial Method...   0.8%   
[binomial] Running Binomial Method...   0.9%   
[binomial] Running Binomial Method...   1.0%   
[binomial] Running Binomial Method...   1.1%   
[binomial] Running Binomial Method...   1.2%   
[binomial] Running Binomial Method...   1.3%   
[binomial] Running Binomial Method...   1.4%   
[binomial] Running Binomial Method...   1.5%   
[binomial] Running Binomial Method...   1.5%   
[binomial] Running Binomial Method...   1.6%   
[binomial] Running Binomial Method...   1.7%   
[binomial] Running Binomial Method...   1.8%   
[binomial] Running Binomial Method...   1.9%   
[binomial] Running Binomial Method...   2.0%   
[binomial] Running Binomial Method...   2.1%   
[binomial] Running Binomial Method...   2.2%   
[binomial] Running Binomial Method...   2.3%   
[binomial] Running Binomial Method...   2.4%   
[binomial] Running Binomial Method...   2.5%   
[binomial] Running Binomial Method...   2.5%   
[binomial] Running Binomial Method...   2.6%   
[binomial] Running Binomial Method...   2.7%   
[binomial] Running Binomial Method...   2.8%   
[binomial] Running Binomial Method...   2.9%   
[binomial] Running Binomial Method...   3.0%   
[binomial] Running Binomial Method...   3.1%   
[binomial] Running Binomial Method...   3.2%   
[binomial] Running Binomial Method...   3.3%   
[binomial] Running Binomial Method...   3.4%   
[binomial] Running Binomial Method...   3.5%   
[binomial] Running Binomial Method...   3.5%   
[binomial] Running Binomial Method...   3.6%   
[binomial] Running Binomial Method...   3.7%   
[binomial] Running Binomial Method...   3.8%   
[binomial] Running Binomial Method...   3.9%   
[binomial] Running Binomial Method...   4.0%   
[binomial] Running Binomial Method...   4.1%   
[binomial] Running Binomial Method...   4.2%   
[binomial] Running Binomial Method...   4.3%   
[binomial] Running Binomial Method...   4.4%   
[binomial] Running Binomial Method...   4.5%   
[binomial] Running Binomial Method...   4.5%   
[binomial] Running Binomial Method...   4.6%   
[binomial] Running Binomial Method...   4.7%   
[binomial] Running Binomial Method...   4.8%   
[binomial] Running Binomial Method...   4.9%   
[binomial] Running Binomial Method...   5.0%   
[binomial] Running Binomial Method...   5.1%   
[binomial] Running Binomial Method...   5.2%   
[binomial] Running Binomial Method...   5.3%   
[binomial] Running Binomial Method...   5.4%   
[binomial] Running Binomial Method...   5.5%   
[binomial] Running Binomial Method...   5.5%   
[binomial] Running Binomial Method...   5.6%   
[binomial] Running Binomial Method...   5.7%   
[binomial] Running Binomial Method...   5.8%   
[binomial] Running Binomial Method...   5.9%   
[binomial] Running Binomial Method...   6.0%   
[binomial] Running Binomial Method...   6.1%   
[binomial] Running Binomial Method...   6.2%   
[binomial] Running Binomial Method...   6.3%   
[binomial] Running Binomial Method...   6.4%   
[binomial] Running Binomial Method...   6.5%   
[binomial] Running Binomial Method...   6.5%   
[binomial] Running Binomial Method...   6.6%   
[binomial] Running Binomial Method...   6.7%   
[binomial] Running Binomial Method...   6.8%   
[binomial] Running Binomial Method...   6.9%   
[binomial] Running Binomial Method...   7.0%   
[binomial] Running Binomial Method...   7.1%   
[binomial] Running Binomial Method...   7.2%   
[binomial] Running Binomial Method...   7.3%   
[binomial] Running Binomial Method...   7.4%   
[binomial] Running Binomial Method...   7.5%   
[binomial] Running Binomial Method...   7.5%   
[binomial] Running Binomial Method...   7.6%   
[binomial] Running Binomial Method...   7.7%   
[binomial] Running Binomial Method...   7.8%   
[binomial] Running Binomial Method...   7.9%   
[binomial] Running Binomial Method...   8.0%   
[binomial] Running Binomial Method...   8.1%   
[binomial] Running Binomial Method...   8.2%   
[binomial] Running Binomial Method...   8.3%   
[binomial] Running Binomial Method...   8.4%   
[binomial] Running Binomial Method...   8.5%   
[binomial] Running Binomial Method...   8.5%   
[binomial] Running Binomial Method...   8.6%   
[binomial] Running Binomial Method...   8.7%   
[binomial] Running Binomial Method...   8.8%   
[binomial] Running Binomial Method...   8.9%   
[binomial] Running Binomial Method...   9.0%   
[binomial] Running Binomial Method...   9.1%   
[binomial] Running Binomial Method...   9.2%   
[binomial] Running Binomial Method...   9.3%   
[binomial] Running Binomial Method...   9.4%   
[binomial] Running Binomial Method...   9.5%   
[binomial] Running Binomial Method...   9.5%   
[binomial] Running Binomial Method...   9.6%   
[binomial] Running Binomial Method...   9.7%   
[binomial] Running Binomial Method...   9.8%   
[binomial] Running Binomial Method...   9.9%   
[binomial] Running Binomial Method...  10.0%   
[binomial] Running Binomial Method...  10.1%   
[binomial] Running Binomial Method...  10.2%   
[binomial] Running Binomial Method...  10.3%   
[binomial] Running Binomial Method...  10.4%   
[binomial] Running Binomial Method...  10.5%   
[binomial] Running Binomial Method...  10.5%   
[binomial] Running Binomial Method...  10.6%   
[binomial] Running Binomial Method...  10.7%   
[binomial] Running Binomial Method...  10.8%   
[binomial] Running Binomial Method...  10.9%   
[binomial] Running Binomial Method...  11.0%   
[binomial] Running Binomial Method...  11.1%   
[binomial] Running Binomial Method...  11.2%   
[binomial] Running Binomial Method...  11.3%   
[binomial] Running Binomial Method...  11.4%   
[binomial] Running Binomial Method...  11.5%   
[binomial] Running Binomial Method...  11.5%   
[binomial] Running Binomial Method...  11.6%   
[binomial] Running Binomial Method...  11.7%   
[binomial] Running Binomial Method...  11.8%   
[binomial] Running Binomial Method...  11.9%   
[binomial] Running Binomial Method...  12.0%   
[binomial] Running Binomial Method...  12.1%   
[binomial] Running Binomial Method...  12.2%   
[binomial] Running Binomial Method...  12.3%   
[binomial] Running Binomial Method...  12.4%   
[binomial] Running Binomial Method...  12.5%   
[binomial] Running Binomial Method...  12.5%   
[binomial] Running Binomial Method...  12.6%   
[binomial] Running Binomial Method...  12.7%   
[binomial] Running Binomial Method...  12.8%   
[binomial] Running Binomial Method...  12.9%   
[binomial] Running Binomial Method...  13.0%   
[binomial] Running Binomial Method...  13.1%   
[binomial] Running Binomial Method...  13.2%   
[binomial] Running Binomial Method...  13.3%   
[binomial] Running Binomial Method...  13.4%   
[binomial] Running Binomial Method...  13.5%   
[binomial] Running Binomial Method...  13.5%   
[binomial] Running Binomial Method...  13.6%   
[binomial] Running Binomial Method...  13.7%   
[binomial] Running Binomial Method...  13.8%   
[binomial] Running Binomial Method...  13.9%   
[binomial] Running Binomial Method...  14.0%   
[binomial] Running Binomial Method...  14.1%   
[binomial] Running Binomial Method...  14.2%   
[binomial] Running Binomial Method...  14.3%   
[binomial] Running Binomial Method...  14.4%   
[binomial] Running Binomial Method...  14.5%   
[binomial] Running Binomial Method...  14.5%   
[binomial] Running Binomial Method...  14.6%   
[binomial] Running Binomial Method...  14.7%   
[binomial] Running Binomial Method...  14.8%   
[binomial] Running Binomial Method...  14.9%   
[binomial] Running Binomial Method...  15.0%   
[binomial] Running Binomial Method...  15.1%   
[binomial] Running Binomial Method...  15.2%   
[binomial] Running Binomial Method...  15.3%   
[binomial] Running Binomial Method...  15.4%   
[binomial] Running Binomial Method...  15.5%   
[binomial] Running Binomial Method...  15.5%   
[binomial] Running Binomial Method...  15.6%   
[binomial] Running Binomial Method...  15.7%   
[binomial] Running Binomial Method...  15.8%   
[binomial] Running Binomial Method...  15.9%   
[binomial] Running Binomial Method...  16.0%   
[binomial] Running Binomial Method...  16.1%   
[binomial] Running Binomial Method...  16.2%   
[binomial] Running Binomial Method...  16.3%   
[binomial] Running Binomial Method...  16.4%   
[binomial] Running Binomial Method...  16.5%   
[binomial] Running Binomial Method...  16.5%   
[binomial] Running Binomial Method...  16.6%   
[binomial] Running Binomial Method...  16.7%   
[binomial] Running Binomial Method...  16.8%   
[binomial] Running Binomial Method...  16.9%   
[binomial] Running Binomial Method...  17.0%   
[binomial] Running Binomial Method...  17.1%   
[binomial] Running Binomial Method...  17.2%   
[binomial] Running Binomial Method...  17.3%   
[binomial] Running Binomial Method...  17.4%   
[binomial] Running Binomial Method...  17.5%   
[binomial] Running Binomial Method...  17.5%   
[binomial] Running Binomial Method...  17.6%   
[binomial] Running Binomial Method...  17.7%   
[binomial] Running Binomial Method...  17.8%   
[binomial] Running Binomial Method...  17.9%   
[binomial] Running Binomial Method...  18.0%   
[binomial] Running Binomial Method...  18.1%   
[binomial] Running Binomial Method...  18.2%   
[binomial] Running Binomial Method...  18.3%   
[binomial] Running Binomial Method...  18.4%   
[binomial] Running Binomial Method...  18.5%   
[binomial] Running Binomial Method...  18.5%   
[binomial] Running Binomial Method...  18.6%   
[binomial] Running Binomial Method...  18.7%   
[binomial] Running Binomial Method...  18.8%   
[binomial] Running Binomial Method...  18.9%   
[binomial] Running Binomial Method...  19.0%   
[binomial] Running Binomial Method...  19.1%   
[binomial] Running Binomial Method...  19.2%   
[binomial] Running Binomial Method...  19.3%   
[binomial] Running Binomial Method...  19.4%   
[binomial] Running Binomial Method...  19.5%   
[binomial] Running Binomial Method...  19.5%   
[binomial] Running Binomial Method...  19.6%   
[binomial] Running Binomial Method...  19.7%   
[binomial] Running Binomial Method...  19.8%   
[binomial] Running Binomial Method...  19.9%   
[binomial] Running Binomial Method...  20.0%   
[binomial] Running Binomial Method...  20.1%   
[binomial] Running Binomial Method...  20.2%   
[binomial] Running Binomial Method...  20.3%   
[binomial] Running Binomial Method...  20.4%   
[binomial] Running Binomial Method...  20.5%   
[binomial] Running Binomial Method...  20.5%   
[binomial] Running Binomial Method...  20.6%   
[binomial] Running Binomial Method...  20.7%   
[binomial] Running Binomial Method...  20.8%   
[binomial] Running Binomial Method...  20.9%   
[binomial] Running Binomial Method...  21.0%   
[binomial] Running Binomial Method...  21.1%   
[binomial] Running Binomial Method...  21.2%   
[binomial] Running Binomial Method...  21.3%   
[binomial] Running Binomial Method...  21.4%   
[binomial] Running Binomial Method...  21.5%   
[binomial] Running Binomial Method...  21.5%   
[binomial] Running Binomial Method...  21.6%   
[binomial] Running Binomial Method...  21.7%   
[binomial] Running Binomial Method...  21.8%   
[binomial] Running Binomial Method...  21.9%   
[binomial] Running Binomial Method...  22.0%   
[binomial] Running Binomial Method...  22.1%   
[binomial] Running Binomial Method...  22.2%   
[binomial] Running Binomial Method...  22.3%   
[binomial] Running Binomial Method...  22.4%   
[binomial] Running Binomial Method...  22.5%   
[binomial] Running Binomial Method...  22.5%   
[binomial] Running Binomial Method...  22.6%   
[binomial] Running Binomial Method...  22.7%   
[binomial] Running Binomial Method...  22.8%   
[binomial] Running Binomial Method...  22.9%   
[binomial] Running Binomial Method...  23.0%   
[binomial] Running Binomial Method...  23.1%   
[binomial] Running Binomial Method...  23.2%   
[binomial] Running Binomial Method...  23.3%   
[binomial] Running Binomial Method...  23.4%   
[binomial] Running Binomial Method...  23.5%   
[binomial] Running Binomial Method...  23.5%   
[binomial] Running Binomial Method...  23.6%   
[binomial] Running Binomial Method...  23.7%   
[binomial] Running Binomial Method...  23.8%   
[binomial] Running Binomial Method...  23.9%   
[binomial] Running Binomial Method...  24.0%   
[binomial] Running Binomial Method...  24.1%   
[binomial] Running Binomial Method...  24.2%   
[binomial] Running Binomial Method...  24.3%   
[binomial] Running Binomial Method...  24.4%   
[binomial] Running Binomial Method...  24.5%   
[binomial] Running Binomial Method...  24.5%   
[binomial] Running Binomial Method...  24.6%   
[binomial] Running Binomial Method...  24.7%   
[binomial] Running Binomial Method...  24.8%   
[binomial] Running Binomial Method...  24.9%   
[binomial] Running Binomial Method...  25.0%   
[binomial] Running Binomial Method...  25.1%   
[binomial] Running Binomial Method...  25.2%   
[binomial] Running Binomial Method...  25.3%   
[binomial] Running Binomial Method...  25.4%   
[binomial] Running Binomial Method...  25.5%   
[binomial] Running Binomial Method...  25.5%   
[binomial] Running Binomial Method...  25.6%   
[binomial] Running Binomial Method...  25.7%   
[binomial] Running Binomial Method...  25.8%   
[binomial] Running Binomial Method...  25.9%   
[binomial] Running Binomial Method...  26.0%   
[binomial] Running Binomial Method...  26.1%   
[binomial] Running Binomial Method...  26.2%   
[binomial] Running Binomial Method...  26.3%   
[binomial] Running Binomial Method...  26.4%   
[binomial] Running Binomial Method...  26.5%   
[binomial] Running Binomial Method...  26.5%   
[binomial] Running Binomial Method...  26.6%   
[binomial] Running Binomial Method...  26.7%   
[binomial] Running Binomial Method...  26.8%   
[binomial] Running Binomial Method...  26.9%   
[binomial] Running Binomial Method...  27.0%   
[binomial] Running Binomial Method...  27.1%   
[binomial] Running Binomial Method...  27.2%   
[binomial] Running Binomial Method...  27.3%   
[binomial] Running Binomial Method...  27.4%   
[binomial] Running Binomial Method...  27.5%   
[binomial] Running Binomial Method...  27.5%   
[binomial] Running Binomial Method...  27.6%   
[binomial] Running Binomial Method...  27.7%   
[binomial] Running Binomial Method...  27.8%   
[binomial] Running Binomial Method...  27.9%   
[binomial] Running Binomial Method...  28.0%   
[binomial] Running Binomial Method...  28.1%   
[binomial] Running Binomial Method...  28.2%   
[binomial] Running Binomial Method...  28.3%   
[binomial] Running Binomial Method...  28.4%   
[binomial] Running Binomial Method...  28.5%   
[binomial] Running Binomial Method...  28.5%   
[binomial] Running Binomial Method...  28.6%   
[binomial] Running Binomial Method...  28.7%   
[binomial] Running Binomial Method...  28.8%   
[binomial] Running Binomial Method...  28.9%   
[binomial] Running Binomial Method...  29.0%   
[binomial] Running Binomial Method...  29.1%   
[binomial] Running Binomial Method...  29.2%   
[binomial] Running Binomial Method...  29.3%   
[binomial] Running Binomial Method...  29.4%   
[binomial] Running Binomial Method...  29.5%   
[binomial] Running Binomial Method...  29.5%   
[binomial] Running Binomial Method...  29.6%   
[binomial] Running Binomial Method...  29.7%   
[binomial] Running Binomial Method...  29.8%   
[binomial] Running Binomial Method...  29.9%   
[binomial] Running Binomial Method...  30.0%   
[binomial] Running Binomial Method...  30.1%   
[binomial] Running Binomial Method...  30.2%   
[binomial] Running Binomial Method...  30.3%   
[binomial] Running Binomial Method...  30.4%   
[binomial] Running Binomial Method...  30.5%   
[binomial] Running Binomial Method...  30.5%   
[binomial] Running Binomial Method...  30.6%   
[binomial] Running Binomial Method...  30.7%   
[binomial] Running Binomial Method...  30.8%   
[binomial] Running Binomial Method...  30.9%   
[binomial] Running Binomial Method...  31.0%   
[binomial] Running Binomial Method...  31.1%   
[binomial] Running Binomial Method...  31.2%   
[binomial] Running Binomial Method...  31.3%   
[binomial] Running Binomial Method...  31.4%   
[binomial] Running Binomial Method...  31.5%   
[binomial] Running Binomial Method...  31.5%   
[binomial] Running Binomial Method...  31.6%   
[binomial] Running Binomial Method...  31.7%   
[binomial] Running Binomial Method...  31.8%   
[binomial] Running Binomial Method...  31.9%   
[binomial] Running Binomial Method...  32.0%   
[binomial] Running Binomial Method...  32.1%   
[binomial] Running Binomial Method...  32.2%   
[binomial] Running Binomial Method...  32.3%   
[binomial] Running Binomial Method...  32.4%   
[binomial] Running Binomial Method...  32.5%   
[binomial] Running Binomial Method...  32.5%   
[binomial] Running Binomial Method...  32.6%   
[binomial] Running Binomial Method...  32.7%   
[binomial] Running Binomial Method...  32.8%   
[binomial] Running Binomial Method...  32.9%   
[binomial] Running Binomial Method...  33.0%   
[binomial] Running Binomial Method...  33.1%   
[binomial] Running Binomial Method...  33.2%   
[binomial] Running Binomial Method...  33.3%   
[binomial] Running Binomial Method...  33.4%   
[binomial] Running Binomial Method...  33.5%   
[binomial] Running Binomial Method...  33.5%   
[binomial] Running Binomial Method...  33.6%   
[binomial] Running Binomial Method...  33.7%   
[binomial] Running Binomial Method...  33.8%   
[binomial] Running Binomial Method...  33.9%   
[binomial] Running Binomial Method...  34.0%   
[binomial] Running Binomial Method...  34.1%   
[binomial] Running Binomial Method...  34.2%   
[binomial] Running Binomial Method...  34.3%   
[binomial] Running Binomial Method...  34.4%   
[binomial] Running Binomial Method...  34.5%   
[binomial] Running Binomial Method...  34.5%   
[binomial] Running Binomial Method...  34.6%   
[binomial] Running Binomial Method...  34.7%   
[binomial] Running Binomial Method...  34.8%   
[binomial] Running Binomial Method...  34.9%   
[binomial] Running Binomial Method...  35.0%   
[binomial] Running Binomial Method...  35.1%   
[binomial] Running Binomial Method...  35.2%   
[binomial] Running Binomial Method...  35.3%   
[binomial] Running Binomial Method...  35.4%   
[binomial] Running Binomial Method...  35.5%   
[binomial] Running Binomial Method...  35.5%   
[binomial] Running Binomial Method...  35.6%   
[binomial] Running Binomial Method...  35.7%   
[binomial] Running Binomial Method...  35.8%   
[binomial] Running Binomial Method...  35.9%   
[binomial] Running Binomial Method...  36.0%   
[binomial] Running Binomial Method...  36.1%   
[binomial] Running Binomial Method...  36.2%   
[binomial] Running Binomial Method...  36.3%   
[binomial] Running Binomial Method...  36.4%   
[binomial] Running Binomial Method...  36.5%   
[binomial] Running Binomial Method...  36.5%   
[binomial] Running Binomial Method...  36.6%   
[binomial] Running Binomial Method...  36.7%   
[binomial] Running Binomial Method...  36.8%   
[binomial] Running Binomial Method...  36.9%   
[binomial] Running Binomial Method...  37.0%   
[binomial] Running Binomial Method...  37.1%   
[binomial] Running Binomial Method...  37.2%   
[binomial] Running Binomial Method...  37.3%   
[binomial] Running Binomial Method...  37.4%   
[binomial] Running Binomial Method...  37.5%   
[binomial] Running Binomial Method...  37.5%   
[binomial] Running Binomial Method...  37.6%   
[binomial] Running Binomial Method...  37.7%   
[binomial] Running Binomial Method...  37.8%   
[binomial] Running Binomial Method...  37.9%   
[binomial] Running Binomial Method...  38.0%   
[binomial] Running Binomial Method...  38.1%   
[binomial] Running Binomial Method...  38.2%   
[binomial] Running Binomial Method...  38.3%   
[binomial] Running Binomial Method...  38.4%   
[binomial] Running Binomial Method...  38.5%   
[binomial] Running Binomial Method...  38.5%   
[binomial] Running Binomial Method...  38.6%   
[binomial] Running Binomial Method...  38.7%   
[binomial] Running Binomial Method...  38.8%   
[binomial] Running Binomial Method...  38.9%   
[binomial] Running Binomial Method...  39.0%   
[binomial] Running Binomial Method...  39.1%   
[binomial] Running Binomial Method...  39.2%   
[binomial] Running Binomial Method...  39.3%   
[binomial] Running Binomial Method...  39.4%   
[binomial] Running Binomial Method...  39.5%   
[binomial] Running Binomial Method...  39.5%   
[binomial] Running Binomial Method...  39.6%   
[binomial] Running Binomial Method...  39.7%   
[binomial] Running Binomial Method...  39.8%   
[binomial] Running Binomial Method...  39.9%   
[binomial] Running Binomial Method...  40.0%   
[binomial] Running Binomial Method...  40.1%   
[binomial] Running Binomial Method...  40.2%   
[binomial] Running Binomial Method...  40.3%   
[binomial] Running Binomial Method...  40.4%   
[binomial] Running Binomial Method...  40.5%   
[binomial] Running Binomial Method...  40.5%   
[binomial] Running Binomial Method...  40.6%   
[binomial] Running Binomial Method...  40.7%   
[binomial] Running Binomial Method...  40.8%   
[binomial] Running Binomial Method...  40.9%   
[binomial] Running Binomial Method...  41.0%   
[binomial] Running Binomial Method...  41.1%   
[binomial] Running Binomial Method...  41.2%   
[binomial] Running Binomial Method...  41.3%   
[binomial] Running Binomial Method...  41.4%   
[binomial] Running Binomial Method...  41.5%   
[binomial] Running Binomial Method...  41.5%   
[binomial] Running Binomial Method...  41.6%   
[binomial] Running Binomial Method...  41.7%   
[binomial] Running Binomial Method...  41.8%   
[binomial] Running Binomial Method...  41.9%   
[binomial] Running Binomial Method...  42.0%   
[binomial] Running Binomial Method...  42.1%   
[binomial] Running Binomial Method...  42.2%   
[binomial] Running Binomial Method...  42.3%   
[binomial] Running Binomial Method...  42.4%   
[binomial] Running Binomial Method...  42.5%   
[binomial] Running Binomial Method...  42.5%   
[binomial] Running Binomial Method...  42.6%   
[binomial] Running Binomial Method...  42.7%   
[binomial] Running Binomial Method...  42.8%   
[binomial] Running Binomial Method...  42.9%   
[binomial] Running Binomial Method...  43.0%   
[binomial] Running Binomial Method...  43.1%   
[binomial] Running Binomial Method...  43.2%   
[binomial] Running Binomial Method...  43.3%   
[binomial] Running Binomial Method...  43.4%   
[binomial] Running Binomial Method...  43.5%   
[binomial] Running Binomial Method...  43.5%   
[binomial] Running Binomial Method...  43.6%   
[binomial] Running Binomial Method...  43.7%   
[binomial] Running Binomial Method...  43.8%   
[binomial] Running Binomial Method...  43.9%   
[binomial] Running Binomial Method...  44.0%   
[binomial] Running Binomial Method...  44.1%   
[binomial] Running Binomial Method...  44.2%   
[binomial] Running Binomial Method...  44.3%   
[binomial] Running Binomial Method...  44.4%   
[binomial] Running Binomial Method...  44.5%   
[binomial] Running Binomial Method...  44.5%   
[binomial] Running Binomial Method...  44.6%   
[binomial] Running Binomial Method...  44.7%   
[binomial] Running Binomial Method...  44.8%   
[binomial] Running Binomial Method...  44.9%   
[binomial] Running Binomial Method...  45.0%   
[binomial] Running Binomial Method...  45.1%   
[binomial] Running Binomial Method...  45.2%   
[binomial] Running Binomial Method...  45.3%   
[binomial] Running Binomial Method...  45.4%   
[binomial] Running Binomial Method...  45.5%   
[binomial] Running Binomial Method...  45.5%   
[binomial] Running Binomial Method...  45.6%   
[binomial] Running Binomial Method...  45.7%   
[binomial] Running Binomial Method...  45.8%   
[binomial] Running Binomial Method...  45.9%   
[binomial] Running Binomial Method...  46.0%   
[binomial] Running Binomial Method...  46.1%   
[binomial] Running Binomial Method...  46.2%   
[binomial] Running Binomial Method...  46.3%   
[binomial] Running Binomial Method...  46.4%   
[binomial] Running Binomial Method...  46.5%   
[binomial] Running Binomial Method...  46.5%   
[binomial] Running Binomial Method...  46.6%   
[binomial] Running Binomial Method...  46.7%   
[binomial] Running Binomial Method...  46.8%   
[binomial] Running Binomial Method...  46.9%   
[binomial] Running Binomial Method...  47.0%   
[binomial] Running Binomial Method...  47.1%   
[binomial] Running Binomial Method...  47.2%   
[binomial] Running Binomial Method...  47.3%   
[binomial] Running Binomial Method...  47.4%   
[binomial] Running Binomial Method...  47.5%   
[binomial] Running Binomial Method...  47.5%   
[binomial] Running Binomial Method...  47.6%   
[binomial] Running Binomial Method...  47.7%   
[binomial] Running Binomial Method...  47.8%   
[binomial] Running Binomial Method...  47.9%   
[binomial] Running Binomial Method...  48.0%   
[binomial] Running Binomial Method...  48.1%   
[binomial] Running Binomial Method...  48.2%   
[binomial] Running Binomial Method...  48.3%   
[binomial] Running Binomial Method...  48.4%   
[binomial] Running Binomial Method...  48.5%   
[binomial] Running Binomial Method...  48.5%   
[binomial] Running Binomial Method...  48.6%   
[binomial] Running Binomial Method...  48.7%   
[binomial] Running Binomial Method...  48.8%   
[binomial] Running Binomial Method...  48.9%   
[binomial] Running Binomial Method...  49.0%   
[binomial] Running Binomial Method...  49.1%   
[binomial] Running Binomial Method...  49.2%   
[binomial] Running Binomial Method...  49.3%   
[binomial] Running Binomial Method...  49.4%   
[binomial] Running Binomial Method...  49.5%   
[binomial] Running Binomial Method...  49.5%   
[binomial] Running Binomial Method...  49.6%   
[binomial] Running Binomial Method...  49.7%   
[binomial] Running Binomial Method...  49.8%   
[binomial] Running Binomial Method...  49.9%   
[binomial] Running Binomial Method...  50.0%   
[binomial] Running Binomial Method...  50.1%   
[binomial] Running Binomial Method...  50.2%   
[binomial] Running Binomial Method...  50.3%   
[binomial] Running Binomial Method...  50.4%   
[binomial] Running Binomial Method...  50.5%   
[binomial] Running Binomial Method...  50.5%   
[binomial] Running Binomial Method...  50.6%   
[binomial] Running Binomial Method...  50.7%   
[binomial] Running Binomial Method...  50.8%   
[binomial] Running Binomial Method...  50.9%   
[binomial] Running Binomial Method...  51.0%   
[binomial] Running Binomial Method...  51.1%   
[binomial] Running Binomial Method...  51.2%   
[binomial] Running Binomial Method...  51.3%   
[binomial] Running Binomial Method...  51.4%   
[binomial] Running Binomial Method...  51.5%   
[binomial] Running Binomial Method...  51.5%   
[binomial] Running Binomial Method...  51.6%   
[binomial] Running Binomial Method...  51.7%   
[binomial] Running Binomial Method...  51.8%   
[binomial] Running Binomial Method...  51.9%   
[binomial] Running Binomial Method...  52.0%   
[binomial] Running Binomial Method...  52.1%   
[binomial] Running Binomial Method...  52.2%   
[binomial] Running Binomial Method...  52.3%   
[binomial] Running Binomial Method...  52.4%   
[binomial] Running Binomial Method...  52.5%   
[binomial] Running Binomial Method...  52.5%   
[binomial] Running Binomial Method...  52.6%   
[binomial] Running Binomial Method...  52.7%   
[binomial] Running Binomial Method...  52.8%   
[binomial] Running Binomial Method...  52.9%   
[binomial] Running Binomial Method...  53.0%   
[binomial] Running Binomial Method...  53.1%   
[binomial] Running Binomial Method...  53.2%   
[binomial] Running Binomial Method...  53.3%   
[binomial] Running Binomial Method...  53.4%   
[binomial] Running Binomial Method...  53.5%   
[binomial] Running Binomial Method...  53.5%   
[binomial] Running Binomial Method...  53.6%   
[binomial] Running Binomial Method...  53.7%   
[binomial] Running Binomial Method...  53.8%   
[binomial] Running Binomial Method...  53.9%   
[binomial] Running Binomial Method...  54.0%   
[binomial] Running Binomial Method...  54.1%   
[binomial] Running Binomial Method...  54.2%   
[binomial] Running Binomial Method...  54.3%   
[binomial] Running Binomial Method...  54.4%   
[binomial] Running Binomial Method...  54.5%   
[binomial] Running Binomial Method...  54.5%   
[binomial] Running Binomial Method...  54.6%   
[binomial] Running Binomial Method...  54.7%   
[binomial] Running Binomial Method...  54.8%   
[binomial] Running Binomial Method...  54.9%   
[binomial] Running Binomial Method...  55.0%   
[binomial] Running Binomial Method...  55.1%   
[binomial] Running Binomial Method...  55.2%   
[binomial] Running Binomial Method...  55.3%   
[binomial] Running Binomial Method...  55.4%   
[binomial] Running Binomial Method...  55.5%   
[binomial] Running Binomial Method...  55.5%   
[binomial] Running Binomial Method...  55.6%   
[binomial] Running Binomial Method...  55.7%   
[binomial] Running Binomial Method...  55.8%   
[binomial] Running Binomial Method...  55.9%   
[binomial] Running Binomial Method...  56.0%   
[binomial] Running Binomial Method...  56.1%   
[binomial] Running Binomial Method...  56.2%   
[binomial] Running Binomial Method...  56.3%   
[binomial] Running Binomial Method...  56.4%   
[binomial] Running Binomial Method...  56.5%   
[binomial] Running Binomial Method...  56.5%   
[binomial] Running Binomial Method...  56.6%   
[binomial] Running Binomial Method...  56.7%   
[binomial] Running Binomial Method...  56.8%   
[binomial] Running Binomial Method...  56.9%   
[binomial] Running Binomial Method...  57.0%   
[binomial] Running Binomial Method...  57.1%   
[binomial] Running Binomial Method...  57.2%   
[binomial] Running Binomial Method...  57.3%   
[binomial] Running Binomial Method...  57.4%   
[binomial] Running Binomial Method...  57.5%   
[binomial] Running Binomial Method...  57.5%   
[binomial] Running Binomial Method...  57.6%   
[binomial] Running Binomial Method...  57.7%   
[binomial] Running Binomial Method...  57.8%   
[binomial] Running Binomial Method...  57.9%   
[binomial] Running Binomial Method...  58.0%   
[binomial] Running Binomial Method...  58.1%   
[binomial] Running Binomial Method...  58.2%   
[binomial] Running Binomial Method...  58.3%   
[binomial] Running Binomial Method...  58.4%   
[binomial] Running Binomial Method...  58.5%   
[binomial] Running Binomial Method...  58.5%   
[binomial] Running Binomial Method...  58.6%   
[binomial] Running Binomial Method...  58.7%   
[binomial] Running Binomial Method...  58.8%   
[binomial] Running Binomial Method...  58.9%   
[binomial] Running Binomial Method...  59.0%   
[binomial] Running Binomial Method...  59.1%   
[binomial] Running Binomial Method...  59.2%   
[binomial] Running Binomial Method...  59.3%   
[binomial] Running Binomial Method...  59.4%   
[binomial] Running Binomial Method...  59.5%   
[binomial] Running Binomial Method...  59.5%   
[binomial] Running Binomial Method...  59.6%   
[binomial] Running Binomial Method...  59.7%   
[binomial] Running Binomial Method...  59.8%   
[binomial] Running Binomial Method...  59.9%   
[binomial] Running Binomial Method...  60.0%   
[binomial] Running Binomial Method...  60.1%   
[binomial] Running Binomial Method...  60.2%   
[binomial] Running Binomial Method...  60.3%   
[binomial] Running Binomial Method...  60.4%   
[binomial] Running Binomial Method...  60.5%   
[binomial] Running Binomial Method...  60.5%   
[binomial] Running Binomial Method...  60.6%   
[binomial] Running Binomial Method...  60.7%   
[binomial] Running Binomial Method...  60.8%   
[binomial] Running Binomial Method...  60.9%   
[binomial] Running Binomial Method...  61.0%   
[binomial] Running Binomial Method...  61.1%   
[binomial] Running Binomial Method...  61.2%   
[binomial] Running Binomial Method...  61.3%   
[binomial] Running Binomial Method...  61.4%   
[binomial] Running Binomial Method...  61.5%   
[binomial] Running Binomial Method...  61.5%   
[binomial] Running Binomial Method...  61.6%   
[binomial] Running Binomial Method...  61.7%   
[binomial] Running Binomial Method...  61.8%   
[binomial] Running Binomial Method...  61.9%   
[binomial] Running Binomial Method...  62.0%   
[binomial] Running Binomial Method...  62.1%   
[binomial] Running Binomial Method...  62.2%   
[binomial] Running Binomial Method...  62.3%   
[binomial] Running Binomial Method...  62.4%   
[binomial] Running Binomial Method...  62.5%   
[binomial] Running Binomial Method...  62.5%   
[binomial] Running Binomial Method...  62.6%   
[binomial] Running Binomial Method...  62.7%   
[binomial] Running Binomial Method...  62.8%   
[binomial] Running Binomial Method...  62.9%   
[binomial] Running Binomial Method...  63.0%   
[binomial] Running Binomial Method...  63.1%   
[binomial] Running Binomial Method...  63.2%   
[binomial] Running Binomial Method...  63.3%   
[binomial] Running Binomial Method...  63.4%   
[binomial] Running Binomial Method...  63.5%   
[binomial] Running Binomial Method...  63.5%   
[binomial] Running Binomial Method...  63.6%   
[binomial] Running Binomial Method...  63.7%   
[binomial] Running Binomial Method...  63.8%   
[binomial] Running Binomial Method...  63.9%   
[binomial] Running Binomial Method...  64.0%   
[binomial] Running Binomial Method...  64.1%   
[binomial] Running Binomial Method...  64.2%   
[binomial] Running Binomial Method...  64.3%   
[binomial] Running Binomial Method...  64.4%   
[binomial] Running Binomial Method...  64.5%   
[binomial] Running Binomial Method...  64.5%   
[binomial] Running Binomial Method...  64.6%   
[binomial] Running Binomial Method...  64.7%   
[binomial] Running Binomial Method...  64.8%   
[binomial] Running Binomial Method...  64.9%   
[binomial] Running Binomial Method...  65.0%   
[binomial] Running Binomial Method...  65.1%   
[binomial] Running Binomial Method...  65.2%   
[binomial] Running Binomial Method...  65.3%   
[binomial] Running Binomial Method...  65.4%   
[binomial] Running Binomial Method...  65.5%   
[binomial] Running Binomial Method...  65.5%   
[binomial] Running Binomial Method...  65.6%   
[binomial] Running Binomial Method...  65.7%   
[binomial] Running Binomial Method...  65.8%   
[binomial] Running Binomial Method...  65.9%   
[binomial] Running Binomial Method...  66.0%   
[binomial] Running Binomial Method...  66.1%   
[binomial] Running Binomial Method...  66.2%   
[binomial] Running Binomial Method...  66.3%   
[binomial] Running Binomial Method...  66.4%   
[binomial] Running Binomial Method...  66.5%   
[binomial] Running Binomial Method...  66.5%   
[binomial] Running Binomial Method...  66.6%   
[binomial] Running Binomial Method...  66.7%   
[binomial] Running Binomial Method...  66.8%   
[binomial] Running Binomial Method...  66.9%   
[binomial] Running Binomial Method...  67.0%   
[binomial] Running Binomial Method...  67.1%   
[binomial] Running Binomial Method...  67.2%   
[binomial] Running Binomial Method...  67.3%   
[binomial] Running Binomial Method...  67.4%   
[binomial] Running Binomial Method...  67.5%   
[binomial] Running Binomial Method...  67.5%   
[binomial] Running Binomial Method...  67.6%   
[binomial] Running Binomial Method...  67.7%   
[binomial] Running Binomial Method...  67.8%   
[binomial] Running Binomial Method...  67.9%   
[binomial] Running Binomial Method...  68.0%   
[binomial] Running Binomial Method...  68.1%   
[binomial] Running Binomial Method...  68.2%   
[binomial] Running Binomial Method...  68.3%   
[binomial] Running Binomial Method...  68.4%   
[binomial] Running Binomial Method...  68.5%   
[binomial] Running Binomial Method...  68.5%   
[binomial] Running Binomial Method...  68.6%   
[binomial] Running Binomial Method...  68.7%   
[binomial] Running Binomial Method...  68.8%   
[binomial] Running Binomial Method...  68.9%   
[binomial] Running Binomial Method...  69.0%   
[binomial] Running Binomial Method...  69.1%   
[binomial] Running Binomial Method...  69.2%   
[binomial] Running Binomial Method...  69.3%   
[binomial] Running Binomial Method...  69.4%   
[binomial] Running Binomial Method...  69.5%   
[binomial] Running Binomial Method...  69.5%   
[binomial] Running Binomial Method...  69.6%   
[binomial] Running Binomial Method...  69.7%   
[binomial] Running Binomial Method...  69.8%   
[binomial] Running Binomial Method...  69.9%   
[binomial] Running Binomial Method...  70.0%   
[binomial] Running Binomial Method...  70.1%   
[binomial] Running Binomial Method...  70.2%   
[binomial] Running Binomial Method...  70.3%   
[binomial] Running Binomial Method...  70.4%   
[binomial] Running Binomial Method...  70.5%   
[binomial] Running Binomial Method...  70.5%   
[binomial] Running Binomial Method...  70.6%   
[binomial] Running Binomial Method...  70.7%   
[binomial] Running Binomial Method...  70.8%   
[binomial] Running Binomial Method...  70.9%   
[binomial] Running Binomial Method...  71.0%   
[binomial] Running Binomial Method...  71.1%   
[binomial] Running Binomial Method...  71.2%   
[binomial] Running Binomial Method...  71.3%   
[binomial] Running Binomial Method...  71.4%   
[binomial] Running Binomial Method...  71.5%   
[binomial] Running Binomial Method...  71.5%   
[binomial] Running Binomial Method...  71.6%   
[binomial] Running Binomial Method...  71.7%   
[binomial] Running Binomial Method...  71.8%   
[binomial] Running Binomial Method...  71.9%   
[binomial] Running Binomial Method...  72.0%   
[binomial] Running Binomial Method...  72.1%   
[binomial] Running Binomial Method...  72.2%   
[binomial] Running Binomial Method...  72.3%   
[binomial] Running Binomial Method...  72.4%   
[binomial] Running Binomial Method...  72.5%   
[binomial] Running Binomial Method...  72.5%   
[binomial] Running Binomial Method...  72.6%   
[binomial] Running Binomial Method...  72.7%   
[binomial] Running Binomial Method...  72.8%   
[binomial] Running Binomial Method...  72.9%   
[binomial] Running Binomial Method...  73.0%   
[binomial] Running Binomial Method...  73.1%   
[binomial] Running Binomial Method...  73.2%   
[binomial] Running Binomial Method...  73.3%   
[binomial] Running Binomial Method...  73.4%   
[binomial] Running Binomial Method...  73.5%   
[binomial] Running Binomial Method...  73.5%   
[binomial] Running Binomial Method...  73.6%   
[binomial] Running Binomial Method...  73.7%   
[binomial] Running Binomial Method...  73.8%   
[binomial] Running Binomial Method...  73.9%   
[binomial] Running Binomial Method...  74.0%   
[binomial] Running Binomial Method...  74.1%   
[binomial] Running Binomial Method...  74.2%   
[binomial] Running Binomial Method...  74.3%   
[binomial] Running Binomial Method...  74.4%   
[binomial] Running Binomial Method...  74.5%   
[binomial] Running Binomial Method...  74.5%   
[binomial] Running Binomial Method...  74.6%   
[binomial] Running Binomial Method...  74.7%   
[binomial] Running Binomial Method...  74.8%   
[binomial] Running Binomial Method...  74.9%   
[binomial] Running Binomial Method...  75.0%   
[binomial] Running Binomial Method...  75.1%   
[binomial] Running Binomial Method...  75.2%   
[binomial] Running Binomial Method...  75.3%   
[binomial] Running Binomial Method...  75.4%   
[binomial] Running Binomial Method...  75.5%   
[binomial] Running Binomial Method...  75.5%   
[binomial] Running Binomial Method...  75.6%   
[binomial] Running Binomial Method...  75.7%   
[binomial] Running Binomial Method...  75.8%   
[binomial] Running Binomial Method...  75.9%   
[binomial] Running Binomial Method...  76.0%   
[binomial] Running Binomial Method...  76.1%   
[binomial] Running Binomial Method...  76.2%   
[binomial] Running Binomial Method...  76.3%   
[binomial] Running Binomial Method...  76.4%   
[binomial] Running Binomial Method...  76.5%   
[binomial] Running Binomial Method...  76.5%   
[binomial] Running Binomial Method...  76.6%   
[binomial] Running Binomial Method...  76.7%   
[binomial] Running Binomial Method...  76.8%   
[binomial] Running Binomial Method...  76.9%   
[binomial] Running Binomial Method...  77.0%   
[binomial] Running Binomial Method...  77.1%   
[binomial] Running Binomial Method...  77.2%   
[binomial] Running Binomial Method...  77.3%   
[binomial] Running Binomial Method...  77.4%   
[binomial] Running Binomial Method...  77.5%   
[binomial] Running Binomial Method...  77.5%   
[binomial] Running Binomial Method...  77.6%   
[binomial] Running Binomial Method...  77.7%   
[binomial] Running Binomial Method...  77.8%   
[binomial] Running Binomial Method...  77.9%   
[binomial] Running Binomial Method...  78.0%   
[binomial] Running Binomial Method...  78.1%   
[binomial] Running Binomial Method...  78.2%   
[binomial] Running Binomial Method...  78.3%   
[binomial] Running Binomial Method...  78.4%   
[binomial] Running Binomial Method...  78.5%   
[binomial] Running Binomial Method...  78.5%   
[binomial] Running Binomial Method...  78.6%   
[binomial] Running Binomial Method...  78.7%   
[binomial] Running Binomial Method...  78.8%   
[binomial] Running Binomial Method...  78.9%   
[binomial] Running Binomial Method...  79.0%   
[binomial] Running Binomial Method...  79.1%   
[binomial] Running Binomial Method...  79.2%   
[binomial] Running Binomial Method...  79.3%   
[binomial] Running Binomial Method...  79.4%   
[binomial] Running Binomial Method...  79.5%   
[binomial] Running Binomial Method...  79.5%   
[binomial] Running Binomial Method...  79.6%   
[binomial] Running Binomial Method...  79.7%   
[binomial] Running Binomial Method...  79.8%   
[binomial] Running Binomial Method...  79.9%   
[binomial] Running Binomial Method...  80.0%   
[binomial] Running Binomial Method...  80.1%   
[binomial] Running Binomial Method...  80.2%   
[binomial] Running Binomial Method...  80.3%   
[binomial] Running Binomial Method...  80.4%   
[binomial] Running Binomial Method...  80.5%   
[binomial] Running Binomial Method...  80.5%   
[binomial] Running Binomial Method...  80.6%   
[binomial] Running Binomial Method...  80.7%   
[binomial] Running Binomial Method...  80.8%   
[binomial] Running Binomial Method...  80.9%   
[binomial] Running Binomial Method...  81.0%   
[binomial] Running Binomial Method...  81.1%   
[binomial] Running Binomial Method...  81.2%   
[binomial] Running Binomial Method...  81.3%   
[binomial] Running Binomial Method...  81.4%   
[binomial] Running Binomial Method...  81.5%   
[binomial] Running Binomial Method...  81.5%   
[binomial] Running Binomial Method...  81.6%   
[binomial] Running Binomial Method...  81.7%   
[binomial] Running Binomial Method...  81.8%   
[binomial] Running Binomial Method...  81.9%   
[binomial] Running Binomial Method...  82.0%   
[binomial] Running Binomial Method...  82.1%   
[binomial] Running Binomial Method...  82.2%   
[binomial] Running Binomial Method...  82.3%   
[binomial] Running Binomial Method...  82.4%   
[binomial] Running Binomial Method...  82.5%   
[binomial] Running Binomial Method...  82.5%   
[binomial] Running Binomial Method...  82.6%   
[binomial] Running Binomial Method...  82.7%   
[binomial] Running Binomial Method...  82.8%   
[binomial] Running Binomial Method...  82.9%   
[binomial] Running Binomial Method...  83.0%   
[binomial] Running Binomial Method...  83.1%   
[binomial] Running Binomial Method...  83.2%   
[binomial] Running Binomial Method...  83.3%   
[binomial] Running Binomial Method...  83.4%   
[binomial] Running Binomial Method...  83.5%   
[binomial] Running Binomial Method...  83.5%   
[binomial] Running Binomial Method...  83.6%   
[binomial] Running Binomial Method...  83.7%   
[binomial] Running Binomial Method...  83.8%   
[binomial] Running Binomial Method...  83.9%   
[binomial] Running Binomial Method...  84.0%   
[binomial] Running Binomial Method...  84.1%   
[binomial] Running Binomial Method...  84.2%   
[binomial] Running Binomial Method...  84.3%   
[binomial] Running Binomial Method...  84.4%   
[binomial] Running Binomial Method...  84.5%   
[binomial] Running Binomial Method...  84.5%   
[binomial] Running Binomial Method...  84.6%   
[binomial] Running Binomial Method...  84.7%   
[binomial] Running Binomial Method...  84.8%   
[binomial] Running Binomial Method...  84.9%   
[binomial] Running Binomial Method...  85.0%   
[binomial] Running Binomial Method...  85.1%   
[binomial] Running Binomial Method...  85.2%   
[binomial] Running Binomial Method...  85.3%   
[binomial] Running Binomial Method...  85.4%   
[binomial] Running Binomial Method...  85.5%   
[binomial] Running Binomial Method...  85.5%   
[binomial] Running Binomial Method...  85.6%   
[binomial] Running Binomial Method...  85.7%   
[binomial] Running Binomial Method...  85.8%   
[binomial] Running Binomial Method...  85.9%   
[binomial] Running Binomial Method...  86.0%   
[binomial] Running Binomial Method...  86.1%   
[binomial] Running Binomial Method...  86.2%   
[binomial] Running Binomial Method...  86.3%   
[binomial] Running Binomial Method...  86.4%   
[binomial] Running Binomial Method...  86.5%   
[binomial] Running Binomial Method...  86.5%   
[binomial] Running Binomial Method...  86.6%   
[binomial] Running Binomial Method...  86.7%   
[binomial] Running Binomial Method...  86.8%   
[binomial] Running Binomial Method...  86.9%   
[binomial] Running Binomial Method...  87.0%   
[binomial] Running Binomial Method...  87.1%   
[binomial] Running Binomial Method...  87.2%   
[binomial] Running Binomial Method...  87.3%   
[binomial] Running Binomial Method...  87.4%   
[binomial] Running Binomial Method...  87.5%   
[binomial] Running Binomial Method...  87.5%   
[binomial] Running Binomial Method...  87.6%   
[binomial] Running Binomial Method...  87.7%   
[binomial] Running Binomial Method...  87.8%   
[binomial] Running Binomial Method...  87.9%   
[binomial] Running Binomial Method...  88.0%   
[binomial] Running Binomial Method...  88.1%   
[binomial] Running Binomial Method...  88.2%   
[binomial] Running Binomial Method...  88.3%   
[binomial] Running Binomial Method...  88.4%   
[binomial] Running Binomial Method...  88.5%   
[binomial] Running Binomial Method...  88.5%   
[binomial] Running Binomial Method...  88.6%   
[binomial] Running Binomial Method...  88.7%   
[binomial] Running Binomial Method...  88.8%   
[binomial] Running Binomial Method...  88.9%   
[binomial] Running Binomial Method...  89.0%   
[binomial] Running Binomial Method...  89.1%   
[binomial] Running Binomial Method...  89.2%   
[binomial] Running Binomial Method...  89.3%   
[binomial] Running Binomial Method...  89.4%   
[binomial] Running Binomial Method...  89.5%   
[binomial] Running Binomial Method...  89.5%   
[binomial] Running Binomial Method...  89.6%   
[binomial] Running Binomial Method...  89.7%   
[binomial] Running Binomial Method...  89.8%   
[binomial] Running Binomial Method...  89.9%   
[binomial] Running Binomial Method...  90.0%   
[binomial] Running Binomial Method...  90.1%   
[binomial] Running Binomial Method...  90.2%   
[binomial] Running Binomial Method...  90.3%   
[binomial] Running Binomial Method...  90.4%   
[binomial] Running Binomial Method...  90.5%   
[binomial] Running Binomial Method...  90.5%   
[binomial] Running Binomial Method...  90.6%   
[binomial] Running Binomial Method...  90.7%   
[binomial] Running Binomial Method...  90.8%   
[binomial] Running Binomial Method...  90.9%   
[binomial] Running Binomial Method...  91.0%   
[binomial] Running Binomial Method...  91.1%   
[binomial] Running Binomial Method...  91.2%   
[binomial] Running Binomial Method...  91.3%   
[binomial] Running Binomial Method...  91.4%   
[binomial] Running Binomial Method...  91.5%   
[binomial] Running Binomial Method...  91.5%   
[binomial] Running Binomial Method...  91.6%   
[binomial] Running Binomial Method...  91.7%   
[binomial] Running Binomial Method...  91.8%   
[binomial] Running Binomial Method...  91.9%   
[binomial] Running Binomial Method...  92.0%   
[binomial] Running Binomial Method...  92.1%   
[binomial] Running Binomial Method...  92.2%   
[binomial] Running Binomial Method...  92.3%   
[binomial] Running Binomial Method...  92.4%   
[binomial] Running Binomial Method...  92.5%   
[binomial] Running Binomial Method...  92.5%   
[binomial] Running Binomial Method...  92.6%   
[binomial] Running Binomial Method...  92.7%   
[binomial] Running Binomial Method...  92.8%   
[binomial] Running Binomial Method...  92.9%   
[binomial] Running Binomial Method...  93.0%   
[binomial] Running Binomial Method...  93.1%   
[binomial] Running Binomial Method...  93.2%   
[binomial] Running Binomial Method...  93.3%   
[binomial] Running Binomial Method...  93.4%   
[binomial] Running Binomial Method...  93.5%   
[binomial] Running Binomial Method...  93.5%   
[binomial] Running Binomial Method...  93.6%   
[binomial] Running Binomial Method...  93.7%   
[binomial] Running Binomial Method...  93.8%   
[binomial] Running Binomial Method...  93.9%   
[binomial] Running Binomial Method...  94.0%   
[binomial] Running Binomial Method...  94.1%   
[binomial] Running Binomial Method...  94.2%   
[binomial] Running Binomial Method...  94.3%   
[binomial] Running Binomial Method...  94.4%   
[binomial] Running Binomial Method...  94.5%   
[binomial] Running Binomial Method...  94.5%   
[binomial] Running Binomial Method...  94.6%   
[binomial] Running Binomial Method...  94.7%   
[binomial] Running Binomial Method...  94.8%   
[binomial] Running Binomial Method...  94.9%   
[binomial] Running Binomial Method...  95.0%   
[binomial] Running Binomial Method...  95.1%   
[binomial] Running Binomial Method...  95.2%   
[binomial] Running Binomial Method...  95.3%   
[binomial] Running Binomial Method...  95.4%   
[binomial] Running Binomial Method...  95.5%   
[binomial] Running Binomial Method...  95.5%   
[binomial] Running Binomial Method...  95.6%   
[binomial] Running Binomial Method...  95.7%   
[binomial] Running Binomial Method...  95.8%   
[binomial] Running Binomial Method...  95.9%   
[binomial] Running Binomial Method...  96.0%   
[binomial] Running Binomial Method...  96.1%   
[binomial] Running Binomial Method...  96.2%   
[binomial] Running Binomial Method...  96.3%   
[binomial] Running Binomial Method...  96.4%   
[binomial] Running Binomial Method...  96.5%   
[binomial] Running Binomial Method...  96.5%   
[binomial] Running Binomial Method...  96.6%   
[binomial] Running Binomial Method...  96.7%   
[binomial] Running Binomial Method...  96.8%   
[binomial] Running Binomial Method...  96.9%   
[binomial] Running Binomial Method...  97.0%   
[binomial] Running Binomial Method...  97.1%   
[binomial] Running Binomial Method...  97.2%   
[binomial] Running Binomial Method...  97.3%   
[binomial] Running Binomial Method...  97.4%   
[binomial] Running Binomial Method...  97.5%   
[binomial] Running Binomial Method...  97.5%   
[binomial] Running Binomial Method...  97.6%   
[binomial] Running Binomial Method...  97.7%   
[binomial] Running Binomial Method...  97.8%   
[binomial] Running Binomial Method...  97.9%   
[binomial] Running Binomial Method...  98.0%   
[binomial] Running Binomial Method...  98.1%   
[binomial] Running Binomial Method...  98.2%   
[binomial] Running Binomial Method...  98.3%   
[binomial] Running Binomial Method...  98.4%   
[binomial] Running Binomial Method...  98.5%   
[binomial] Running Binomial Method...  98.5%   
[binomial] Running Binomial Method...  98.6%   
[binomial] Running Binomial Method...  98.7%   
[binomial] Running Binomial Method...  98.8%   
[binomial] Running Binomial Method...  98.9%   
[binomial] Running Binomial Method...  99.0%   
[binomial] Running Binomial Method...  99.1%   
[binomial] Running Binomial Method...  99.2%   
[binomial] Running Binomial Method...  99.3%   
[binomial] Running Binomial Method...  99.4%   
[binomial] Running Binomial Method...  99.5%   
[binomial] Running Binomial Method...  99.5%   
[binomial] Running Binomial Method...  99.6%   
[binomial] Running Binomial Method...  99.7%   
[binomial] Running Binomial Method...  99.8%   
[binomial] Running Binomial Method...  99.9%   
[binomial] Running Binomial Method... 100.0%   
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
  for line in open(self.annotation):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_GI (tests.test_analysis_methods.TestMethods) ... [binomial] 
[binomial] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[binomial] Finished Binomial Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_GI
####################
[gi] Starting Genetic Interactions Method
[gi] Getting Data
[gi] Normalizing using: TTR
[gi] Running GI Method...  2%   
[gi] Running Export Method... 0.0%   
[gi] Running GI Method...  4%   
[gi] Running Export Method... 2.0%   
[gi] Running GI Method...  6%   
[gi] Running Export Method... 4.0%   
[gi] Running GI Method...  8%   
[gi] Running Export Method... 6.0%   
[gi] Running GI Method... 10%   
[gi] Running Export Method... 8.0%   
[gi] Running GI Method... 12%   
[gi] Running Export Method... 10.0%   
[gi] Running GI Method... 14%   
[gi] Running Export Method... 12.0%   
[gi] Running GI Method... 16%   
[gi] Running Export Method... 14.0%   
[gi] Running GI Method... 18%   
[gi] Running Export Method... 16.0%   
[gi] Running GI Method... 20%   
[gi] Running Export Method... 18.0%   
[gi] Running GI Method... 22%   
[gi] Running Export Method... 20.0%   
[gi] Running GI Method... 24%   
[gi] Running Export Method... 22.0%   
[gi] Running GI Method... 25%   
[gi] Running Export Method... 24.0%   
[gi] Running GI Method... 27%   
[gi] Running Export Method... 26.0%   
[gi] Running GI Method... 29%   
[gi] Running Export Method... 28.0%   
[gi] Running GI Method... 31%   
[gi] Running Export Method... 30.0%   
[gi] Running GI Method... 33%   
[gi] Running Export Method... 32.0%   
[gi] Running GI Method... 35%   
[gi] Running Export Method... 34.0%   
[gi] Running GI Method... 37%   
[gi] Running Export Method... 36.0%   
[gi] Running GI Method... 39%   
[gi] Running Export Method... 38.0%   
[gi] Running GI Method... 41%   
[gi] Running Export Method... 40.0%   
[gi] Running GI Method... 43%   
[gi] Running Export Method... 42.0%   
[gi] Running GI Method... 45%   
[gi] Running Export Method... 44.0%   
[gi] Running GI Method... 47%   
[gi] Running Export Method... 46.0%   
[gi] Running GI Method... 49%   
[gi] Running Export Method... 48.0%   
[gi] Running GI Method... 51%   
[gi] Running Export Method... 50.0%   
[gi] Running GI Method... 53%   
[gi] Running Export Method... 52.0%   
[gi] Running GI Method... 55%   
[gi] Running Export Method... 54.0%   
[gi] Running GI Method... 57%   
[gi] Running Export Method... 56.0%   
[gi] Running GI Method... 59%   
[gi] Running Export Method... 58.0%   
[gi] Running GI Method... 61%   
[gi] Running Export Method... 60.0%   
[gi] Running GI Method... 63%   
[gi] Running Export Method... 62.0%   
[gi] Running GI Method... 65%   
[gi] Running Export Method... 64.0%   
[gi] Running GI Method... 67%   
[gi] Running Export Method... 66.0%   
[gi] Running GI Method... 69%   
[gi] Running Export Method... 68.0%   
[gi] Running GI Method... 71%   
[gi] Running Export Method... 70.0%   
[gi] Running GI Method... 73%   
[gi] Running Export Method... 72.0%   
[gi] Running GI Method... 75%   
[gi] Running Export Method... 74.0%   
[gi] Running GI Method... 76%   
[gi] Running Export Method... 76.0%   
[gi] Running GI Method... 78%   
[gi] Running Export Method... 78.0%   
[gi] Running GI Method... 80%   
[gi] Running Export Method... 80.0%   
[gi] Running GI Method... 82%   
[gi] Running Export Method... 82.0%   
[gi] Running GI Method... 84%   
[gi] Running Export Method... 84.0%   
[gi] Running GI Method... 86%   
[gi] Running Export Method... 86.0%   
[gi] Running GI Method... 88%   
[gi] Running Export Method... 88.0%   
[gi] Running GI Method... 90%   
[gi] Running Export Method... 90.0%   
[gi] Running GI Method... 92%   
[gi] Running Export Method... 92.0%   
[gi] Running GI Method... 94%   
[gi] Running Export Method... 94.0%   
[gi] Running GI Method... 96%   
[gi] Running Export Method... 96.0%   
[gi] Running GI Method... 98%   
[gi] Running Export Method... 98.0%   
[gi] Running GI Method... 100%   
[gi] Running Export Method... 100.0%   
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/usr/lib/python3.8/unittest/case.py:633: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='w' encoding='UTF-8'>
  method()
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_Griffin (tests.test_analysis_methods.TestMethods) ... [gi] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[gi] Finished Genetic Interactions Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_Griffin
####################
[griffin] Starting Griffin Method
[griffin] Getting Data
[griffin] Running Griffin Method...   2.0%   
[griffin] Running Griffin Method...   3.9%   
[griffin] Running Griffin Method...   5.9%   
[griffin] Running Griffin Method...   7.8%   
[griffin] Running Griffin Method...   9.8%   
[griffin] Running Griffin Method...  11.8%   
[griffin] Running Griffin Method...  13.7%   
[griffin] Running Griffin Method...  15.7%   
[griffin] Running Griffin Method...  17.6%   
[griffin] Running Griffin Method...  19.6%   
[griffin] Running Griffin Method...  21.6%   
[griffin] Running Griffin Method...  23.5%   
[griffin] Running Griffin Method...  25.5%   
[griffin] Running Griffin Method...  27.5%   
[griffin] Running Griffin Method...  29.4%   
[griffin] Running Griffin Method...  31.4%   
[griffin] Running Griffin Method...  33.3%   
[griffin] Running Griffin Method...  35.3%   
[griffin] Running Griffin Method...  37.3%   
[griffin] Running Griffin Method...  39.2%   
[griffin] Running Griffin Method...  41.2%   
[griffin] Running Griffin Method...  43.1%   
[griffin] Running Griffin Method...  45.1%   
[griffin] Running Griffin Method...  47.1%   
[griffin] Running Griffin Method...  49.0%   
[griffin] Running Griffin Method...  51.0%   
[griffin] Running Griffin Method...  52.9%   
[griffin] Running Griffin Method...  54.9%   
[griffin] Running Griffin Method...  56.9%   
[griffin] Running Griffin Method...  58.8%   
[griffin] Running Griffin Method...  60.8%   
[griffin] Running Griffin Method...  62.7%   
[griffin] Running Griffin Method...  64.7%   
[griffin] Running Griffin Method...  66.7%   
[griffin] Running Griffin Method...  68.6%   
[griffin] Running Griffin Method...  70.6%   
[griffin] Running Griffin Method...  72.5%   
[griffin] Running Griffin Method...  74.5%   
[griffin] Running Griffin Method...  76.5%   
[griffin] Running Griffin Method...  78.4%   
[griffin] Running Griffin Method...  80.4%   
[griffin] Running Griffin Method...  82.4%   
[griffin] Running Griffin Method...  84.3%   
[griffin] Running Griffin Method...  86.3%   
[griffin] Running Griffin Method...  88.2%   
[griffin] Running Griffin Method...  90.2%   
[griffin] Running Griffin Method...  92.2%   
[griffin] Running Griffin Method...  94.1%   
[griffin] Running Griffin Method...  96.1%   
[griffin] Running Griffin Method...  98.0%   
[griffin] Running Griffin Method... 100.0%   
ok
test_Gumbel (tests.test_analysis_methods.TestMethods) ... [griffin] 
[griffin] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[griffin] Finished Griffin Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_Gumbel
####################
[gumbel] Reading Annotation
[gumbel] Getting Data
[gumbel] Doing Regression
[gumbel] Setting Initial Class
[gumbel] Running Gumbel Method...   0.2%   
[gumbel] Running Gumbel Method...   0.3%   
[gumbel] Running Gumbel Method...   0.4%   
[gumbel] Running Gumbel Method...   0.5%   
[gumbel] Running Gumbel Method...   0.5%   
[gumbel] Running Gumbel Method...   0.6%   
[gumbel] Running Gumbel Method...   0.7%   
[gumbel] Running Gumbel Method...   0.8%   
[gumbel] Running Gumbel Method...   0.9%   
[gumbel] Running Gumbel Method...   1.0%   
[gumbel] Running Gumbel Method...   1.1%   
[gumbel] Running Gumbel Method...   1.2%   
[gumbel] Running Gumbel Method...   1.3%   
[gumbel] Running Gumbel Method...   1.4%   
[gumbel] Running Gumbel Method...   1.5%   
[gumbel] Running Gumbel Method...   1.5%   
[gumbel] Running Gumbel Method...   1.6%   
[gumbel] Running Gumbel Method...   1.7%   
[gumbel] Running Gumbel Method...   1.8%   
[gumbel] Running Gumbel Method...   1.9%   
[gumbel] Running Gumbel Method...   2.0%   
[gumbel] Running Gumbel Method...   2.1%   
[gumbel] Running Gumbel Method...   2.2%   
[gumbel] Running Gumbel Method...   2.3%   
[gumbel] Running Gumbel Method...   2.4%   
[gumbel] Running Gumbel Method...   2.5%   
[gumbel] Running Gumbel Method...   2.5%   
[gumbel] Running Gumbel Method...   2.6%   
[gumbel] Running Gumbel Method...   2.7%   
[gumbel] Running Gumbel Method...   2.8%   
[gumbel] Running Gumbel Method...   2.9%   
[gumbel] Running Gumbel Method...   3.0%   
[gumbel] Running Gumbel Method...   3.1%   
[gumbel] Running Gumbel Method...   3.2%   
[gumbel] Running Gumbel Method...   3.3%   
[gumbel] Running Gumbel Method...   3.4%   
[gumbel] Running Gumbel Method...   3.5%   
[gumbel] Running Gumbel Method...   3.5%   
[gumbel] Running Gumbel Method...   3.6%   
[gumbel] Running Gumbel Method...   3.7%   
[gumbel] Running Gumbel Method...   3.8%   
[gumbel] Running Gumbel Method...   3.9%   
[gumbel] Running Gumbel Method...   4.0%   
[gumbel] Running Gumbel Method...   4.1%   
[gumbel] Running Gumbel Method...   4.2%   
[gumbel] Running Gumbel Method...   4.3%   
[gumbel] Running Gumbel Method...   4.4%   
[gumbel] Running Gumbel Method...   4.5%   
[gumbel] Running Gumbel Method...   4.5%   
[gumbel] Running Gumbel Method...   4.6%   
[gumbel] Running Gumbel Method...   4.7%   
[gumbel] Running Gumbel Method...   4.8%   
[gumbel] Running Gumbel Method...   4.9%   
[gumbel] Running Gumbel Method...   5.0%   
[gumbel] Running Gumbel Method...   5.1%   
[gumbel] Running Gumbel Method...   5.2%   
[gumbel] Running Gumbel Method...   5.3%   
[gumbel] Running Gumbel Method...   5.4%   
[gumbel] Running Gumbel Method...   5.5%   
[gumbel] Running Gumbel Method...   5.5%   
[gumbel] Running Gumbel Method...   5.6%   
[gumbel] Running Gumbel Method...   5.7%   
[gumbel] Running Gumbel Method...   5.8%   
[gumbel] Running Gumbel Method...   5.9%   
[gumbel] Running Gumbel Method...   6.0%   
[gumbel] Running Gumbel Method...   6.1%   
[gumbel] Running Gumbel Method...   6.2%   
[gumbel] Running Gumbel Method...   6.3%   
[gumbel] Running Gumbel Method...   6.4%   
[gumbel] Running Gumbel Method...   6.5%   
[gumbel] Running Gumbel Method...   6.5%   
[gumbel] Running Gumbel Method...   6.6%   
[gumbel] Running Gumbel Method...   6.7%   
[gumbel] Running Gumbel Method...   6.8%   
[gumbel] Running Gumbel Method...   6.9%   
[gumbel] Running Gumbel Method...   7.0%   
[gumbel] Running Gumbel Method...   7.1%   
[gumbel] Running Gumbel Method...   7.2%   
[gumbel] Running Gumbel Method...   7.3%   
[gumbel] Running Gumbel Method...   7.4%   
[gumbel] Running Gumbel Method...   7.5%   
[gumbel] Running Gumbel Method...   7.5%   
[gumbel] Running Gumbel Method...   7.6%   
[gumbel] Running Gumbel Method...   7.7%   
[gumbel] Running Gumbel Method...   7.8%   
[gumbel] Running Gumbel Method...   7.9%   
[gumbel] Running Gumbel Method...   8.0%   
[gumbel] Running Gumbel Method...   8.1%   
[gumbel] Running Gumbel Method...   8.2%   
[gumbel] Running Gumbel Method...   8.3%   
[gumbel] Running Gumbel Method...   8.4%   
[gumbel] Running Gumbel Method...   8.5%   
[gumbel] Running Gumbel Method...   8.5%   
[gumbel] Running Gumbel Method...   8.6%   
[gumbel] Running Gumbel Method...   8.7%   
[gumbel] Running Gumbel Method...   8.8%   
[gumbel] Running Gumbel Method...   8.9%   
[gumbel] Running Gumbel Method...   9.0%   
[gumbel] Running Gumbel Method...   9.1%   
[gumbel] Running Gumbel Method...   9.2%   
[gumbel] Running Gumbel Method...   9.3%   
[gumbel] Running Gumbel Method...   9.4%   
[gumbel] Running Gumbel Method...   9.5%   
[gumbel] Running Gumbel Method...   9.5%   
[gumbel] Running Gumbel Method...   9.6%   
[gumbel] Running Gumbel Method...   9.7%   
[gumbel] Running Gumbel Method...   9.8%   
[gumbel] Running Gumbel Method...   9.9%   
[gumbel] Running Gumbel Method...  10.0%   
[gumbel] Running Gumbel Method...  10.1%   
[gumbel] Running Gumbel Method...  10.2%   
[gumbel] Running Gumbel Method...  10.3%   
[gumbel] Running Gumbel Method...  10.4%   
[gumbel] Running Gumbel Method...  10.5%   
[gumbel] Running Gumbel Method...  10.5%   
[gumbel] Running Gumbel Method...  10.6%   
[gumbel] Running Gumbel Method...  10.7%   
[gumbel] Running Gumbel Method...  10.8%   
[gumbel] Running Gumbel Method...  10.9%   
[gumbel] Running Gumbel Method...  11.0%   
[gumbel] Running Gumbel Method...  11.1%   
[gumbel] Running Gumbel Method...  11.2%   
[gumbel] Running Gumbel Method...  11.3%   
[gumbel] Running Gumbel Method...  11.4%   
[gumbel] Running Gumbel Method...  11.5%   
[gumbel] Running Gumbel Method...  11.5%   
[gumbel] Running Gumbel Method...  11.6%   
[gumbel] Running Gumbel Method...  11.7%   
[gumbel] Running Gumbel Method...  11.8%   
[gumbel] Running Gumbel Method...  11.9%   
[gumbel] Running Gumbel Method...  12.0%   
[gumbel] Running Gumbel Method...  12.1%   
[gumbel] Running Gumbel Method...  12.2%   
[gumbel] Running Gumbel Method...  12.3%   
[gumbel] Running Gumbel Method...  12.4%   
[gumbel] Running Gumbel Method...  12.5%   
[gumbel] Running Gumbel Method...  12.5%   
[gumbel] Running Gumbel Method...  12.6%   
[gumbel] Running Gumbel Method...  12.7%   
[gumbel] Running Gumbel Method...  12.8%   
[gumbel] Running Gumbel Method...  12.9%   
[gumbel] Running Gumbel Method...  13.0%   
[gumbel] Running Gumbel Method...  13.1%   
[gumbel] Running Gumbel Method...  13.2%   
[gumbel] Running Gumbel Method...  13.3%   
[gumbel] Running Gumbel Method...  13.4%   
[gumbel] Running Gumbel Method...  13.5%   
[gumbel] Running Gumbel Method...  13.5%   
[gumbel] Running Gumbel Method...  13.6%   
[gumbel] Running Gumbel Method...  13.7%   
[gumbel] Running Gumbel Method...  13.8%   
[gumbel] Running Gumbel Method...  13.9%   
[gumbel] Running Gumbel Method...  14.0%   
[gumbel] Running Gumbel Method...  14.1%   
[gumbel] Running Gumbel Method...  14.2%   
[gumbel] Running Gumbel Method...  14.3%   
[gumbel] Running Gumbel Method...  14.4%   
[gumbel] Running Gumbel Method...  14.5%   
[gumbel] Running Gumbel Method...  14.5%   
[gumbel] Running Gumbel Method...  14.6%   
[gumbel] Running Gumbel Method...  14.7%   
[gumbel] Running Gumbel Method...  14.8%   
[gumbel] Running Gumbel Method...  14.9%   
[gumbel] Running Gumbel Method...  15.0%   
[gumbel] Running Gumbel Method...  15.1%   
[gumbel] Running Gumbel Method...  15.2%   
[gumbel] Running Gumbel Method...  15.3%   
[gumbel] Running Gumbel Method...  15.4%   
[gumbel] Running Gumbel Method...  15.5%   
[gumbel] Running Gumbel Method...  15.5%   
[gumbel] Running Gumbel Method...  15.6%   
[gumbel] Running Gumbel Method...  15.7%   
[gumbel] Running Gumbel Method...  15.8%   
[gumbel] Running Gumbel Method...  15.9%   
[gumbel] Running Gumbel Method...  16.0%   
[gumbel] Running Gumbel Method...  16.1%   
[gumbel] Running Gumbel Method...  16.2%   
[gumbel] Running Gumbel Method...  16.3%   
[gumbel] Running Gumbel Method...  16.4%   
[gumbel] Running Gumbel Method...  16.5%   
[gumbel] Running Gumbel Method...  16.5%   
[gumbel] Running Gumbel Method...  16.6%   
[gumbel] Running Gumbel Method...  16.7%   
[gumbel] Running Gumbel Method...  16.8%   
[gumbel] Running Gumbel Method...  16.9%   
[gumbel] Running Gumbel Method...  17.0%   
[gumbel] Running Gumbel Method...  17.1%   
[gumbel] Running Gumbel Method...  17.2%   
[gumbel] Running Gumbel Method...  17.3%   
[gumbel] Running Gumbel Method...  17.4%   
[gumbel] Running Gumbel Method...  17.5%   
[gumbel] Running Gumbel Method...  17.5%   
[gumbel] Running Gumbel Method...  17.6%   
[gumbel] Running Gumbel Method...  17.7%   
[gumbel] Running Gumbel Method...  17.8%   
[gumbel] Running Gumbel Method...  17.9%   
[gumbel] Running Gumbel Method...  18.0%   
[gumbel] Running Gumbel Method...  18.1%   
[gumbel] Running Gumbel Method...  18.2%   
[gumbel] Running Gumbel Method...  18.3%   
[gumbel] Running Gumbel Method...  18.4%   
[gumbel] Running Gumbel Method...  18.5%   
[gumbel] Running Gumbel Method...  18.5%   
[gumbel] Running Gumbel Method...  18.6%   
[gumbel] Running Gumbel Method...  18.7%   
[gumbel] Running Gumbel Method...  18.8%   
[gumbel] Running Gumbel Method...  18.9%   
[gumbel] Running Gumbel Method...  19.0%   
[gumbel] Running Gumbel Method...  19.1%   
[gumbel] Running Gumbel Method...  19.2%   
[gumbel] Running Gumbel Method...  19.3%   
[gumbel] Running Gumbel Method...  19.4%   
[gumbel] Running Gumbel Method...  19.5%   
[gumbel] Running Gumbel Method...  19.5%   
[gumbel] Running Gumbel Method...  19.6%   
[gumbel] Running Gumbel Method...  19.7%   
[gumbel] Running Gumbel Method...  19.8%   
[gumbel] Running Gumbel Method...  19.9%   
[gumbel] Running Gumbel Method...  20.0%   
[gumbel] Running Gumbel Method...  20.1%   
[gumbel] Running Gumbel Method...  20.2%   
[gumbel] Running Gumbel Method...  20.3%   
[gumbel] Running Gumbel Method...  20.4%   
[gumbel] Running Gumbel Method...  20.5%   
[gumbel] Running Gumbel Method...  20.5%   
[gumbel] Running Gumbel Method...  20.6%   
[gumbel] Running Gumbel Method...  20.7%   
[gumbel] Running Gumbel Method...  20.8%   
[gumbel] Running Gumbel Method...  20.9%   
[gumbel] Running Gumbel Method...  21.0%   
[gumbel] Running Gumbel Method...  21.1%   
[gumbel] Running Gumbel Method...  21.2%   
[gumbel] Running Gumbel Method...  21.3%   
[gumbel] Running Gumbel Method...  21.4%   
[gumbel] Running Gumbel Method...  21.5%   
[gumbel] Running Gumbel Method...  21.5%   
[gumbel] Running Gumbel Method...  21.6%   
[gumbel] Running Gumbel Method...  21.7%   
[gumbel] Running Gumbel Method...  21.8%   
[gumbel] Running Gumbel Method...  21.9%   
[gumbel] Running Gumbel Method...  22.0%   
[gumbel] Running Gumbel Method...  22.1%   
[gumbel] Running Gumbel Method...  22.2%   
[gumbel] Running Gumbel Method...  22.3%   
[gumbel] Running Gumbel Method...  22.4%   
[gumbel] Running Gumbel Method...  22.5%   
[gumbel] Running Gumbel Method...  22.5%   
[gumbel] Running Gumbel Method...  22.6%   
[gumbel] Running Gumbel Method...  22.7%   
[gumbel] Running Gumbel Method...  22.8%   
[gumbel] Running Gumbel Method...  22.9%   
[gumbel] Running Gumbel Method...  23.0%   
[gumbel] Running Gumbel Method...  23.1%   
[gumbel] Running Gumbel Method...  23.2%   
[gumbel] Running Gumbel Method...  23.3%   
[gumbel] Running Gumbel Method...  23.4%   
[gumbel] Running Gumbel Method...  23.5%   
[gumbel] Running Gumbel Method...  23.5%   
[gumbel] Running Gumbel Method...  23.6%   
[gumbel] Running Gumbel Method...  23.7%   
[gumbel] Running Gumbel Method...  23.8%   
[gumbel] Running Gumbel Method...  23.9%   
[gumbel] Running Gumbel Method...  24.0%   
[gumbel] Running Gumbel Method...  24.1%   
[gumbel] Running Gumbel Method...  24.2%   
[gumbel] Running Gumbel Method...  24.3%   
[gumbel] Running Gumbel Method...  24.4%   
[gumbel] Running Gumbel Method...  24.5%   
[gumbel] Running Gumbel Method...  24.5%   
[gumbel] Running Gumbel Method...  24.6%   
[gumbel] Running Gumbel Method...  24.7%   
[gumbel] Running Gumbel Method...  24.8%   
[gumbel] Running Gumbel Method...  24.9%   
[gumbel] Running Gumbel Method...  25.0%   
[gumbel] Running Gumbel Method...  25.1%   
[gumbel] Running Gumbel Method...  25.2%   
[gumbel] Running Gumbel Method...  25.3%   
[gumbel] Running Gumbel Method...  25.4%   
[gumbel] Running Gumbel Method...  25.5%   
[gumbel] Running Gumbel Method...  25.5%   
[gumbel] Running Gumbel Method...  25.6%   
[gumbel] Running Gumbel Method...  25.7%   
[gumbel] Running Gumbel Method...  25.8%   
[gumbel] Running Gumbel Method...  25.9%   
[gumbel] Running Gumbel Method...  26.0%   
[gumbel] Running Gumbel Method...  26.1%   
[gumbel] Running Gumbel Method...  26.2%   
[gumbel] Running Gumbel Method...  26.3%   
[gumbel] Running Gumbel Method...  26.4%   
[gumbel] Running Gumbel Method...  26.5%   
[gumbel] Running Gumbel Method...  26.5%   
[gumbel] Running Gumbel Method...  26.6%   
[gumbel] Running Gumbel Method...  26.7%   
[gumbel] Running Gumbel Method...  26.8%   
[gumbel] Running Gumbel Method...  26.9%   
[gumbel] Running Gumbel Method...  27.0%   
[gumbel] Running Gumbel Method...  27.1%   
[gumbel] Running Gumbel Method...  27.2%   
[gumbel] Running Gumbel Method...  27.3%   
[gumbel] Running Gumbel Method...  27.4%   
[gumbel] Running Gumbel Method...  27.5%   
[gumbel] Running Gumbel Method...  27.5%   
[gumbel] Running Gumbel Method...  27.6%   
[gumbel] Running Gumbel Method...  27.7%   
[gumbel] Running Gumbel Method...  27.8%   
[gumbel] Running Gumbel Method...  27.9%   
[gumbel] Running Gumbel Method...  28.0%   
[gumbel] Running Gumbel Method...  28.1%   
[gumbel] Running Gumbel Method...  28.2%   
[gumbel] Running Gumbel Method...  28.3%   
[gumbel] Running Gumbel Method...  28.4%   
[gumbel] Running Gumbel Method...  28.5%   
[gumbel] Running Gumbel Method...  28.5%   
[gumbel] Running Gumbel Method...  28.6%   
[gumbel] Running Gumbel Method...  28.7%   
[gumbel] Running Gumbel Method...  28.8%   
[gumbel] Running Gumbel Method...  28.9%   
[gumbel] Running Gumbel Method...  29.0%   
[gumbel] Running Gumbel Method...  29.1%   
[gumbel] Running Gumbel Method...  29.2%   
[gumbel] Running Gumbel Method...  29.3%   
[gumbel] Running Gumbel Method...  29.4%   
[gumbel] Running Gumbel Method...  29.5%   
[gumbel] Running Gumbel Method...  29.5%   
[gumbel] Running Gumbel Method...  29.6%   
[gumbel] Running Gumbel Method...  29.7%   
[gumbel] Running Gumbel Method...  29.8%   
[gumbel] Running Gumbel Method...  29.9%   
[gumbel] Running Gumbel Method...  30.0%   
[gumbel] Running Gumbel Method...  30.1%   
[gumbel] Running Gumbel Method...  30.2%   
[gumbel] Running Gumbel Method...  30.3%   
[gumbel] Running Gumbel Method...  30.4%   
[gumbel] Running Gumbel Method...  30.5%   
[gumbel] Running Gumbel Method...  30.5%   
[gumbel] Running Gumbel Method...  30.6%   
[gumbel] Running Gumbel Method...  30.7%   
[gumbel] Running Gumbel Method...  30.8%   
[gumbel] Running Gumbel Method...  30.9%   
[gumbel] Running Gumbel Method...  31.0%   
[gumbel] Running Gumbel Method...  31.1%   
[gumbel] Running Gumbel Method...  31.2%   
[gumbel] Running Gumbel Method...  31.3%   
[gumbel] Running Gumbel Method...  31.4%   
[gumbel] Running Gumbel Method...  31.5%   
[gumbel] Running Gumbel Method...  31.5%   
[gumbel] Running Gumbel Method...  31.6%   
[gumbel] Running Gumbel Method...  31.7%   
[gumbel] Running Gumbel Method...  31.8%   
[gumbel] Running Gumbel Method...  31.9%   
[gumbel] Running Gumbel Method...  32.0%   
[gumbel] Running Gumbel Method...  32.1%   
[gumbel] Running Gumbel Method...  32.2%   
[gumbel] Running Gumbel Method...  32.3%   
[gumbel] Running Gumbel Method...  32.4%   
[gumbel] Running Gumbel Method...  32.5%   
[gumbel] Running Gumbel Method...  32.5%   
[gumbel] Running Gumbel Method...  32.6%   
[gumbel] Running Gumbel Method...  32.7%   
[gumbel] Running Gumbel Method...  32.8%   
[gumbel] Running Gumbel Method...  32.9%   
[gumbel] Running Gumbel Method...  33.0%   
[gumbel] Running Gumbel Method...  33.1%   
[gumbel] Running Gumbel Method...  33.2%   
[gumbel] Running Gumbel Method...  33.3%   
[gumbel] Running Gumbel Method...  33.4%   
[gumbel] Running Gumbel Method...  33.5%   
[gumbel] Running Gumbel Method...  33.5%   
[gumbel] Running Gumbel Method...  33.6%   
[gumbel] Running Gumbel Method...  33.7%   
[gumbel] Running Gumbel Method...  33.8%   
[gumbel] Running Gumbel Method...  33.9%   
[gumbel] Running Gumbel Method...  34.0%   
[gumbel] Running Gumbel Method...  34.1%   
[gumbel] Running Gumbel Method...  34.2%   
[gumbel] Running Gumbel Method...  34.3%   
[gumbel] Running Gumbel Method...  34.4%   
[gumbel] Running Gumbel Method...  34.5%   
[gumbel] Running Gumbel Method...  34.5%   
[gumbel] Running Gumbel Method...  34.6%   
[gumbel] Running Gumbel Method...  34.7%   
[gumbel] Running Gumbel Method...  34.8%   
[gumbel] Running Gumbel Method...  34.9%   
[gumbel] Running Gumbel Method...  35.0%   
[gumbel] Running Gumbel Method...  35.1%   
[gumbel] Running Gumbel Method...  35.2%   
[gumbel] Running Gumbel Method...  35.3%   
[gumbel] Running Gumbel Method...  35.4%   
[gumbel] Running Gumbel Method...  35.5%   
[gumbel] Running Gumbel Method...  35.5%   
[gumbel] Running Gumbel Method...  35.6%   
[gumbel] Running Gumbel Method...  35.7%   
[gumbel] Running Gumbel Method...  35.8%   
[gumbel] Running Gumbel Method...  35.9%   
[gumbel] Running Gumbel Method...  36.0%   
[gumbel] Running Gumbel Method...  36.1%   
[gumbel] Running Gumbel Method...  36.2%   
[gumbel] Running Gumbel Method...  36.3%   
[gumbel] Running Gumbel Method...  36.4%   
[gumbel] Running Gumbel Method...  36.5%   
[gumbel] Running Gumbel Method...  36.5%   
[gumbel] Running Gumbel Method...  36.6%   
[gumbel] Running Gumbel Method...  36.7%   
[gumbel] Running Gumbel Method...  36.8%   
[gumbel] Running Gumbel Method...  36.9%   
[gumbel] Running Gumbel Method...  37.0%   
[gumbel] Running Gumbel Method...  37.1%   
[gumbel] Running Gumbel Method...  37.2%   
[gumbel] Running Gumbel Method...  37.3%   
[gumbel] Running Gumbel Method...  37.4%   
[gumbel] Running Gumbel Method...  37.5%   
[gumbel] Running Gumbel Method...  37.5%   
[gumbel] Running Gumbel Method...  37.6%   
[gumbel] Running Gumbel Method...  37.7%   
[gumbel] Running Gumbel Method...  37.8%   
[gumbel] Running Gumbel Method...  37.9%   
[gumbel] Running Gumbel Method...  38.0%   
[gumbel] Running Gumbel Method...  38.1%   
[gumbel] Running Gumbel Method...  38.2%   
[gumbel] Running Gumbel Method...  38.3%   
[gumbel] Running Gumbel Method...  38.4%   
[gumbel] Running Gumbel Method...  38.5%   
[gumbel] Running Gumbel Method...  38.5%   
[gumbel] Running Gumbel Method...  38.6%   
[gumbel] Running Gumbel Method...  38.7%   
[gumbel] Running Gumbel Method...  38.8%   
[gumbel] Running Gumbel Method...  38.9%   
[gumbel] Running Gumbel Method...  39.0%   
[gumbel] Running Gumbel Method...  39.1%   
[gumbel] Running Gumbel Method...  39.2%   
[gumbel] Running Gumbel Method...  39.3%   
[gumbel] Running Gumbel Method...  39.4%   
[gumbel] Running Gumbel Method...  39.5%   
[gumbel] Running Gumbel Method...  39.5%   
[gumbel] Running Gumbel Method...  39.6%   
[gumbel] Running Gumbel Method...  39.7%   
[gumbel] Running Gumbel Method...  39.8%   
[gumbel] Running Gumbel Method...  39.9%   
[gumbel] Running Gumbel Method...  40.0%   
[gumbel] Running Gumbel Method...  40.1%   
[gumbel] Running Gumbel Method...  40.2%   
[gumbel] Running Gumbel Method...  40.3%   
[gumbel] Running Gumbel Method...  40.4%   
[gumbel] Running Gumbel Method...  40.5%   
[gumbel] Running Gumbel Method...  40.5%   
[gumbel] Running Gumbel Method...  40.6%   
[gumbel] Running Gumbel Method...  40.7%   
[gumbel] Running Gumbel Method...  40.8%   
[gumbel] Running Gumbel Method...  40.9%   
[gumbel] Running Gumbel Method...  41.0%   
[gumbel] Running Gumbel Method...  41.1%   
[gumbel] Running Gumbel Method...  41.2%   
[gumbel] Running Gumbel Method...  41.3%   
[gumbel] Running Gumbel Method...  41.4%   
[gumbel] Running Gumbel Method...  41.5%   
[gumbel] Running Gumbel Method...  41.5%   
[gumbel] Running Gumbel Method...  41.6%   
[gumbel] Running Gumbel Method...  41.7%   
[gumbel] Running Gumbel Method...  41.8%   
[gumbel] Running Gumbel Method...  41.9%   
[gumbel] Running Gumbel Method...  42.0%   
[gumbel] Running Gumbel Method...  42.1%   
[gumbel] Running Gumbel Method...  42.2%   
[gumbel] Running Gumbel Method...  42.3%   
[gumbel] Running Gumbel Method...  42.4%   
[gumbel] Running Gumbel Method...  42.5%   
[gumbel] Running Gumbel Method...  42.5%   
[gumbel] Running Gumbel Method...  42.6%   
[gumbel] Running Gumbel Method...  42.7%   
[gumbel] Running Gumbel Method...  42.8%   
[gumbel] Running Gumbel Method...  42.9%   
[gumbel] Running Gumbel Method...  43.0%   
[gumbel] Running Gumbel Method...  43.1%   
[gumbel] Running Gumbel Method...  43.2%   
[gumbel] Running Gumbel Method...  43.3%   
[gumbel] Running Gumbel Method...  43.4%   
[gumbel] Running Gumbel Method...  43.5%   
[gumbel] Running Gumbel Method...  43.5%   
[gumbel] Running Gumbel Method...  43.6%   
[gumbel] Running Gumbel Method...  43.7%   
[gumbel] Running Gumbel Method...  43.8%   
[gumbel] Running Gumbel Method...  43.9%   
[gumbel] Running Gumbel Method...  44.0%   
[gumbel] Running Gumbel Method...  44.1%   
[gumbel] Running Gumbel Method...  44.2%   
[gumbel] Running Gumbel Method...  44.3%   
[gumbel] Running Gumbel Method...  44.4%   
[gumbel] Running Gumbel Method...  44.5%   
[gumbel] Running Gumbel Method...  44.5%   
[gumbel] Running Gumbel Method...  44.6%   
[gumbel] Running Gumbel Method...  44.7%   
[gumbel] Running Gumbel Method...  44.8%   
[gumbel] Running Gumbel Method...  44.9%   
[gumbel] Running Gumbel Method...  45.0%   
[gumbel] Running Gumbel Method...  45.1%   
[gumbel] Running Gumbel Method...  45.2%   
[gumbel] Running Gumbel Method...  45.3%   
[gumbel] Running Gumbel Method...  45.4%   
[gumbel] Running Gumbel Method...  45.5%   
[gumbel] Running Gumbel Method...  45.5%   
[gumbel] Running Gumbel Method...  45.6%   
[gumbel] Running Gumbel Method...  45.7%   
[gumbel] Running Gumbel Method...  45.8%   
[gumbel] Running Gumbel Method...  45.9%   
[gumbel] Running Gumbel Method...  46.0%   
[gumbel] Running Gumbel Method...  46.1%   
[gumbel] Running Gumbel Method...  46.2%   
[gumbel] Running Gumbel Method...  46.3%   
[gumbel] Running Gumbel Method...  46.4%   
[gumbel] Running Gumbel Method...  46.5%   
[gumbel] Running Gumbel Method...  46.5%   
[gumbel] Running Gumbel Method...  46.6%   
[gumbel] Running Gumbel Method...  46.7%   
[gumbel] Running Gumbel Method...  46.8%   
[gumbel] Running Gumbel Method...  46.9%   
[gumbel] Running Gumbel Method...  47.0%   
[gumbel] Running Gumbel Method...  47.1%   
[gumbel] Running Gumbel Method...  47.2%   
[gumbel] Running Gumbel Method...  47.3%   
[gumbel] Running Gumbel Method...  47.4%   
[gumbel] Running Gumbel Method...  47.5%   
[gumbel] Running Gumbel Method...  47.5%   
[gumbel] Running Gumbel Method...  47.6%   
[gumbel] Running Gumbel Method...  47.7%   
[gumbel] Running Gumbel Method...  47.8%   
[gumbel] Running Gumbel Method...  47.9%   
[gumbel] Running Gumbel Method...  48.0%   
[gumbel] Running Gumbel Method...  48.1%   
[gumbel] Running Gumbel Method...  48.2%   
[gumbel] Running Gumbel Method...  48.3%   
[gumbel] Running Gumbel Method...  48.4%   
[gumbel] Running Gumbel Method...  48.5%   
[gumbel] Running Gumbel Method...  48.5%   
[gumbel] Running Gumbel Method...  48.6%   
[gumbel] Running Gumbel Method...  48.7%   
[gumbel] Running Gumbel Method...  48.8%   
[gumbel] Running Gumbel Method...  48.9%   
[gumbel] Running Gumbel Method...  49.0%   
[gumbel] Running Gumbel Method...  49.1%   
[gumbel] Running Gumbel Method...  49.2%   
[gumbel] Running Gumbel Method...  49.3%   
[gumbel] Running Gumbel Method...  49.4%   
[gumbel] Running Gumbel Method...  49.5%   
[gumbel] Running Gumbel Method...  49.5%   
[gumbel] Running Gumbel Method...  49.6%   
[gumbel] Running Gumbel Method...  49.7%   
[gumbel] Running Gumbel Method...  49.8%   
[gumbel] Running Gumbel Method...  49.9%   
[gumbel] Running Gumbel Method...  50.0%   
[gumbel] Running Gumbel Method...  50.1%   
[gumbel] Running Gumbel Method...  50.2%   
[gumbel] Running Gumbel Method...  50.3%   
[gumbel] Running Gumbel Method...  50.4%   
[gumbel] Running Gumbel Method...  50.5%   
[gumbel] Running Gumbel Method...  50.5%   
[gumbel] Running Gumbel Method...  50.6%   
[gumbel] Running Gumbel Method...  50.7%   
[gumbel] Running Gumbel Method...  50.8%   
[gumbel] Running Gumbel Method...  50.9%   
[gumbel] Running Gumbel Method...  51.0%   
[gumbel] Running Gumbel Method...  51.1%   
[gumbel] Running Gumbel Method...  51.2%   
[gumbel] Running Gumbel Method...  51.3%   
[gumbel] Running Gumbel Method...  51.4%   
[gumbel] Running Gumbel Method...  51.5%   
[gumbel] Running Gumbel Method...  51.5%   
[gumbel] Running Gumbel Method...  51.6%   
[gumbel] Running Gumbel Method...  51.7%   
[gumbel] Running Gumbel Method...  51.8%   
[gumbel] Running Gumbel Method...  51.9%   
[gumbel] Running Gumbel Method...  52.0%   
[gumbel] Running Gumbel Method...  52.1%   
[gumbel] Running Gumbel Method...  52.2%   
[gumbel] Running Gumbel Method...  52.3%   
[gumbel] Running Gumbel Method...  52.4%   
[gumbel] Running Gumbel Method...  52.5%   
[gumbel] Running Gumbel Method...  52.5%   
[gumbel] Running Gumbel Method...  52.6%   
[gumbel] Running Gumbel Method...  52.7%   
[gumbel] Running Gumbel Method...  52.8%   
[gumbel] Running Gumbel Method...  52.9%   
[gumbel] Running Gumbel Method...  53.0%   
[gumbel] Running Gumbel Method...  53.1%   
[gumbel] Running Gumbel Method...  53.2%   
[gumbel] Running Gumbel Method...  53.3%   
[gumbel] Running Gumbel Method...  53.4%   
[gumbel] Running Gumbel Method...  53.5%   
[gumbel] Running Gumbel Method...  53.5%   
[gumbel] Running Gumbel Method...  53.6%   
[gumbel] Running Gumbel Method...  53.7%   
[gumbel] Running Gumbel Method...  53.8%   
[gumbel] Running Gumbel Method...  53.9%   
[gumbel] Running Gumbel Method...  54.0%   
[gumbel] Running Gumbel Method...  54.1%   
[gumbel] Running Gumbel Method...  54.2%   
[gumbel] Running Gumbel Method...  54.3%   
[gumbel] Running Gumbel Method...  54.4%   
[gumbel] Running Gumbel Method...  54.5%   
[gumbel] Running Gumbel Method...  54.5%   
[gumbel] Running Gumbel Method...  54.6%   
[gumbel] Running Gumbel Method...  54.7%   
[gumbel] Running Gumbel Method...  54.8%   
[gumbel] Running Gumbel Method...  54.9%   
[gumbel] Running Gumbel Method...  55.0%   
[gumbel] Running Gumbel Method...  55.1%   
[gumbel] Running Gumbel Method...  55.2%   
[gumbel] Running Gumbel Method...  55.3%   
[gumbel] Running Gumbel Method...  55.4%   
[gumbel] Running Gumbel Method...  55.5%   
[gumbel] Running Gumbel Method...  55.5%   
[gumbel] Running Gumbel Method...  55.6%   
[gumbel] Running Gumbel Method...  55.7%   
[gumbel] Running Gumbel Method...  55.8%   
[gumbel] Running Gumbel Method...  55.9%   
[gumbel] Running Gumbel Method...  56.0%   
[gumbel] Running Gumbel Method...  56.1%   
[gumbel] Running Gumbel Method...  56.2%   
[gumbel] Running Gumbel Method...  56.3%   
[gumbel] Running Gumbel Method...  56.4%   
[gumbel] Running Gumbel Method...  56.5%   
[gumbel] Running Gumbel Method...  56.5%   
[gumbel] Running Gumbel Method...  56.6%   
[gumbel] Running Gumbel Method...  56.7%   
[gumbel] Running Gumbel Method...  56.8%   
[gumbel] Running Gumbel Method...  56.9%   
[gumbel] Running Gumbel Method...  57.0%   
[gumbel] Running Gumbel Method...  57.1%   
[gumbel] Running Gumbel Method...  57.2%   
[gumbel] Running Gumbel Method...  57.3%   
[gumbel] Running Gumbel Method...  57.4%   
[gumbel] Running Gumbel Method...  57.5%   
[gumbel] Running Gumbel Method...  57.5%   
[gumbel] Running Gumbel Method...  57.6%   
[gumbel] Running Gumbel Method...  57.7%   
[gumbel] Running Gumbel Method...  57.8%   
[gumbel] Running Gumbel Method...  57.9%   
[gumbel] Running Gumbel Method...  58.0%   
[gumbel] Running Gumbel Method...  58.1%   
[gumbel] Running Gumbel Method...  58.2%   
[gumbel] Running Gumbel Method...  58.3%   
[gumbel] Running Gumbel Method...  58.4%   
[gumbel] Running Gumbel Method...  58.5%   
[gumbel] Running Gumbel Method...  58.5%   
[gumbel] Running Gumbel Method...  58.6%   
[gumbel] Running Gumbel Method...  58.7%   
[gumbel] Running Gumbel Method...  58.8%   
[gumbel] Running Gumbel Method...  58.9%   
[gumbel] Running Gumbel Method...  59.0%   
[gumbel] Running Gumbel Method...  59.1%   
[gumbel] Running Gumbel Method...  59.2%   
[gumbel] Running Gumbel Method...  59.3%   
[gumbel] Running Gumbel Method...  59.4%   
[gumbel] Running Gumbel Method...  59.5%   
[gumbel] Running Gumbel Method...  59.5%   
[gumbel] Running Gumbel Method...  59.6%   
[gumbel] Running Gumbel Method...  59.7%   
[gumbel] Running Gumbel Method...  59.8%   
[gumbel] Running Gumbel Method...  59.9%   
[gumbel] Running Gumbel Method...  60.0%   
[gumbel] Running Gumbel Method...  60.1%   
[gumbel] Running Gumbel Method...  60.2%   
[gumbel] Running Gumbel Method...  60.3%   
[gumbel] Running Gumbel Method...  60.4%   
[gumbel] Running Gumbel Method...  60.5%   
[gumbel] Running Gumbel Method...  60.5%   
[gumbel] Running Gumbel Method...  60.6%   
[gumbel] Running Gumbel Method...  60.7%   
[gumbel] Running Gumbel Method...  60.8%   
[gumbel] Running Gumbel Method...  60.9%   
[gumbel] Running Gumbel Method...  61.0%   
[gumbel] Running Gumbel Method...  61.1%   
[gumbel] Running Gumbel Method...  61.2%   
[gumbel] Running Gumbel Method...  61.3%   
[gumbel] Running Gumbel Method...  61.4%   
[gumbel] Running Gumbel Method...  61.5%   
[gumbel] Running Gumbel Method...  61.5%   
[gumbel] Running Gumbel Method...  61.6%   
[gumbel] Running Gumbel Method...  61.7%   
[gumbel] Running Gumbel Method...  61.8%   
[gumbel] Running Gumbel Method...  61.9%   
[gumbel] Running Gumbel Method...  62.0%   
[gumbel] Running Gumbel Method...  62.1%   
[gumbel] Running Gumbel Method...  62.2%   
[gumbel] Running Gumbel Method...  62.3%   
[gumbel] Running Gumbel Method...  62.4%   
[gumbel] Running Gumbel Method...  62.5%   
[gumbel] Running Gumbel Method...  62.5%   
[gumbel] Running Gumbel Method...  62.6%   
[gumbel] Running Gumbel Method...  62.7%   
[gumbel] Running Gumbel Method...  62.8%   
[gumbel] Running Gumbel Method...  62.9%   
[gumbel] Running Gumbel Method...  63.0%   
[gumbel] Running Gumbel Method...  63.1%   
[gumbel] Running Gumbel Method...  63.2%   
[gumbel] Running Gumbel Method...  63.3%   
[gumbel] Running Gumbel Method...  63.4%   
[gumbel] Running Gumbel Method...  63.5%   
[gumbel] Running Gumbel Method...  63.5%   
[gumbel] Running Gumbel Method...  63.6%   
[gumbel] Running Gumbel Method...  63.7%   
[gumbel] Running Gumbel Method...  63.8%   
[gumbel] Running Gumbel Method...  63.9%   
[gumbel] Running Gumbel Method...  64.0%   
[gumbel] Running Gumbel Method...  64.1%   
[gumbel] Running Gumbel Method...  64.2%   
[gumbel] Running Gumbel Method...  64.3%   
[gumbel] Running Gumbel Method...  64.4%   
[gumbel] Running Gumbel Method...  64.5%   
[gumbel] Running Gumbel Method...  64.5%   
[gumbel] Running Gumbel Method...  64.6%   
[gumbel] Running Gumbel Method...  64.7%   
[gumbel] Running Gumbel Method...  64.8%   
[gumbel] Running Gumbel Method...  64.9%   
[gumbel] Running Gumbel Method...  65.0%   
[gumbel] Running Gumbel Method...  65.1%   
[gumbel] Running Gumbel Method...  65.2%   
[gumbel] Running Gumbel Method...  65.3%   
[gumbel] Running Gumbel Method...  65.4%   
[gumbel] Running Gumbel Method...  65.5%   
[gumbel] Running Gumbel Method...  65.5%   
[gumbel] Running Gumbel Method...  65.6%   
[gumbel] Running Gumbel Method...  65.7%   
[gumbel] Running Gumbel Method...  65.8%   
[gumbel] Running Gumbel Method...  65.9%   
[gumbel] Running Gumbel Method...  66.0%   
[gumbel] Running Gumbel Method...  66.1%   
[gumbel] Running Gumbel Method...  66.2%   
[gumbel] Running Gumbel Method...  66.3%   
[gumbel] Running Gumbel Method...  66.4%   
[gumbel] Running Gumbel Method...  66.5%   
[gumbel] Running Gumbel Method...  66.5%   
[gumbel] Running Gumbel Method...  66.6%   
[gumbel] Running Gumbel Method...  66.7%   
[gumbel] Running Gumbel Method...  66.8%   
[gumbel] Running Gumbel Method...  66.9%   
[gumbel] Running Gumbel Method...  67.0%   
[gumbel] Running Gumbel Method...  67.1%   
[gumbel] Running Gumbel Method...  67.2%   
[gumbel] Running Gumbel Method...  67.3%   
[gumbel] Running Gumbel Method...  67.4%   
[gumbel] Running Gumbel Method...  67.5%   
[gumbel] Running Gumbel Method...  67.5%   
[gumbel] Running Gumbel Method...  67.6%   
[gumbel] Running Gumbel Method...  67.7%   
[gumbel] Running Gumbel Method...  67.8%   
[gumbel] Running Gumbel Method...  67.9%   
[gumbel] Running Gumbel Method...  68.0%   
[gumbel] Running Gumbel Method...  68.1%   
[gumbel] Running Gumbel Method...  68.2%   
[gumbel] Running Gumbel Method...  68.3%   
[gumbel] Running Gumbel Method...  68.4%   
[gumbel] Running Gumbel Method...  68.5%   
[gumbel] Running Gumbel Method...  68.5%   
[gumbel] Running Gumbel Method...  68.6%   
[gumbel] Running Gumbel Method...  68.7%   
[gumbel] Running Gumbel Method...  68.8%   
[gumbel] Running Gumbel Method...  68.9%   
[gumbel] Running Gumbel Method...  69.0%   
[gumbel] Running Gumbel Method...  69.1%   
[gumbel] Running Gumbel Method...  69.2%   
[gumbel] Running Gumbel Method...  69.3%   
[gumbel] Running Gumbel Method...  69.4%   
[gumbel] Running Gumbel Method...  69.5%   
[gumbel] Running Gumbel Method...  69.5%   
[gumbel] Running Gumbel Method...  69.6%   
[gumbel] Running Gumbel Method...  69.7%   
[gumbel] Running Gumbel Method...  69.8%   
[gumbel] Running Gumbel Method...  69.9%   
[gumbel] Running Gumbel Method...  70.0%   
[gumbel] Running Gumbel Method...  70.1%   
[gumbel] Running Gumbel Method...  70.2%   
[gumbel] Running Gumbel Method...  70.3%   
[gumbel] Running Gumbel Method...  70.4%   
[gumbel] Running Gumbel Method...  70.5%   
[gumbel] Running Gumbel Method...  70.5%   
[gumbel] Running Gumbel Method...  70.6%   
[gumbel] Running Gumbel Method...  70.7%   
[gumbel] Running Gumbel Method...  70.8%   
[gumbel] Running Gumbel Method...  70.9%   
[gumbel] Running Gumbel Method...  71.0%   
[gumbel] Running Gumbel Method...  71.1%   
[gumbel] Running Gumbel Method...  71.2%   
[gumbel] Running Gumbel Method...  71.3%   
[gumbel] Running Gumbel Method...  71.4%   
[gumbel] Running Gumbel Method...  71.5%   
[gumbel] Running Gumbel Method...  71.5%   
[gumbel] Running Gumbel Method...  71.6%   
[gumbel] Running Gumbel Method...  71.7%   
[gumbel] Running Gumbel Method...  71.8%   
[gumbel] Running Gumbel Method...  71.9%   
[gumbel] Running Gumbel Method...  72.0%   
[gumbel] Running Gumbel Method...  72.1%   
[gumbel] Running Gumbel Method...  72.2%   
[gumbel] Running Gumbel Method...  72.3%   
[gumbel] Running Gumbel Method...  72.4%   
[gumbel] Running Gumbel Method...  72.5%   
[gumbel] Running Gumbel Method...  72.5%   
[gumbel] Running Gumbel Method...  72.6%   
[gumbel] Running Gumbel Method...  72.7%   
[gumbel] Running Gumbel Method...  72.8%   
[gumbel] Running Gumbel Method...  72.9%   
[gumbel] Running Gumbel Method...  73.0%   
[gumbel] Running Gumbel Method...  73.1%   
[gumbel] Running Gumbel Method...  73.2%   
[gumbel] Running Gumbel Method...  73.3%   
[gumbel] Running Gumbel Method...  73.4%   
[gumbel] Running Gumbel Method...  73.5%   
[gumbel] Running Gumbel Method...  73.5%   
[gumbel] Running Gumbel Method...  73.6%   
[gumbel] Running Gumbel Method...  73.7%   
[gumbel] Running Gumbel Method...  73.8%   
[gumbel] Running Gumbel Method...  73.9%   
[gumbel] Running Gumbel Method...  74.0%   
[gumbel] Running Gumbel Method...  74.1%   
[gumbel] Running Gumbel Method...  74.2%   
[gumbel] Running Gumbel Method...  74.3%   
[gumbel] Running Gumbel Method...  74.4%   
[gumbel] Running Gumbel Method...  74.5%   
[gumbel] Running Gumbel Method...  74.5%   
[gumbel] Running Gumbel Method...  74.6%   
[gumbel] Running Gumbel Method...  74.7%   
[gumbel] Running Gumbel Method...  74.8%   
[gumbel] Running Gumbel Method...  74.9%   
[gumbel] Running Gumbel Method...  75.0%   
[gumbel] Running Gumbel Method...  75.1%   
[gumbel] Running Gumbel Method...  75.2%   
[gumbel] Running Gumbel Method...  75.3%   
[gumbel] Running Gumbel Method...  75.4%   
[gumbel] Running Gumbel Method...  75.5%   
[gumbel] Running Gumbel Method...  75.5%   
[gumbel] Running Gumbel Method...  75.6%   
[gumbel] Running Gumbel Method...  75.7%   
[gumbel] Running Gumbel Method...  75.8%   
[gumbel] Running Gumbel Method...  75.9%   
[gumbel] Running Gumbel Method...  76.0%   
[gumbel] Running Gumbel Method...  76.1%   
[gumbel] Running Gumbel Method...  76.2%   
[gumbel] Running Gumbel Method...  76.3%   
[gumbel] Running Gumbel Method...  76.4%   
[gumbel] Running Gumbel Method...  76.5%   
[gumbel] Running Gumbel Method...  76.5%   
[gumbel] Running Gumbel Method...  76.6%   
[gumbel] Running Gumbel Method...  76.7%   
[gumbel] Running Gumbel Method...  76.8%   
[gumbel] Running Gumbel Method...  76.9%   
[gumbel] Running Gumbel Method...  77.0%   
[gumbel] Running Gumbel Method...  77.1%   
[gumbel] Running Gumbel Method...  77.2%   
[gumbel] Running Gumbel Method...  77.3%   
[gumbel] Running Gumbel Method...  77.4%   
[gumbel] Running Gumbel Method...  77.5%   
[gumbel] Running Gumbel Method...  77.5%   
[gumbel] Running Gumbel Method...  77.6%   
[gumbel] Running Gumbel Method...  77.7%   
[gumbel] Running Gumbel Method...  77.8%   
[gumbel] Running Gumbel Method...  77.9%   
[gumbel] Running Gumbel Method...  78.0%   
[gumbel] Running Gumbel Method...  78.1%   
[gumbel] Running Gumbel Method...  78.2%   
[gumbel] Running Gumbel Method...  78.3%   
[gumbel] Running Gumbel Method...  78.4%   
[gumbel] Running Gumbel Method...  78.5%   
[gumbel] Running Gumbel Method...  78.5%   
[gumbel] Running Gumbel Method...  78.6%   
[gumbel] Running Gumbel Method...  78.7%   
[gumbel] Running Gumbel Method...  78.8%   
[gumbel] Running Gumbel Method...  78.9%   
[gumbel] Running Gumbel Method...  79.0%   
[gumbel] Running Gumbel Method...  79.1%   
[gumbel] Running Gumbel Method...  79.2%   
[gumbel] Running Gumbel Method...  79.3%   
[gumbel] Running Gumbel Method...  79.4%   
[gumbel] Running Gumbel Method...  79.5%   
[gumbel] Running Gumbel Method...  79.5%   
[gumbel] Running Gumbel Method...  79.6%   
[gumbel] Running Gumbel Method...  79.7%   
[gumbel] Running Gumbel Method...  79.8%   
[gumbel] Running Gumbel Method...  79.9%   
[gumbel] Running Gumbel Method...  80.0%   
[gumbel] Running Gumbel Method...  80.1%   
[gumbel] Running Gumbel Method...  80.2%   
[gumbel] Running Gumbel Method...  80.3%   
[gumbel] Running Gumbel Method...  80.4%   
[gumbel] Running Gumbel Method...  80.5%   
[gumbel] Running Gumbel Method...  80.5%   
[gumbel] Running Gumbel Method...  80.6%   
[gumbel] Running Gumbel Method...  80.7%   
[gumbel] Running Gumbel Method...  80.8%   
[gumbel] Running Gumbel Method...  80.9%   
[gumbel] Running Gumbel Method...  81.0%   
[gumbel] Running Gumbel Method...  81.1%   
[gumbel] Running Gumbel Method...  81.2%   
[gumbel] Running Gumbel Method...  81.3%   
[gumbel] Running Gumbel Method...  81.4%   
[gumbel] Running Gumbel Method...  81.5%   
[gumbel] Running Gumbel Method...  81.5%   
[gumbel] Running Gumbel Method...  81.6%   
[gumbel] Running Gumbel Method...  81.7%   
[gumbel] Running Gumbel Method...  81.8%   
[gumbel] Running Gumbel Method...  81.9%   
[gumbel] Running Gumbel Method...  82.0%   
[gumbel] Running Gumbel Method...  82.1%   
[gumbel] Running Gumbel Method...  82.2%   
[gumbel] Running Gumbel Method...  82.3%   
[gumbel] Running Gumbel Method...  82.4%   
[gumbel] Running Gumbel Method...  82.5%   
[gumbel] Running Gumbel Method...  82.5%   
[gumbel] Running Gumbel Method...  82.6%   
[gumbel] Running Gumbel Method...  82.7%   
[gumbel] Running Gumbel Method...  82.8%   
[gumbel] Running Gumbel Method...  82.9%   
[gumbel] Running Gumbel Method...  83.0%   
[gumbel] Running Gumbel Method...  83.1%   
[gumbel] Running Gumbel Method...  83.2%   
[gumbel] Running Gumbel Method...  83.3%   
[gumbel] Running Gumbel Method...  83.4%   
[gumbel] Running Gumbel Method...  83.5%   
[gumbel] Running Gumbel Method...  83.5%   
[gumbel] Running Gumbel Method...  83.6%   
[gumbel] Running Gumbel Method...  83.7%   
[gumbel] Running Gumbel Method...  83.8%   
[gumbel] Running Gumbel Method...  83.9%   
[gumbel] Running Gumbel Method...  84.0%   
[gumbel] Running Gumbel Method...  84.1%   
[gumbel] Running Gumbel Method...  84.2%   
[gumbel] Running Gumbel Method...  84.3%   
[gumbel] Running Gumbel Method...  84.4%   
[gumbel] Running Gumbel Method...  84.5%   
[gumbel] Running Gumbel Method...  84.5%   
[gumbel] Running Gumbel Method...  84.6%   
[gumbel] Running Gumbel Method...  84.7%   
[gumbel] Running Gumbel Method...  84.8%   
[gumbel] Running Gumbel Method...  84.9%   
[gumbel] Running Gumbel Method...  85.0%   
[gumbel] Running Gumbel Method...  85.1%   
[gumbel] Running Gumbel Method...  85.2%   
[gumbel] Running Gumbel Method...  85.3%   
[gumbel] Running Gumbel Method...  85.4%   
[gumbel] Running Gumbel Method...  85.5%   
[gumbel] Running Gumbel Method...  85.5%   
[gumbel] Running Gumbel Method...  85.6%   
[gumbel] Running Gumbel Method...  85.7%   
[gumbel] Running Gumbel Method...  85.8%   
[gumbel] Running Gumbel Method...  85.9%   
[gumbel] Running Gumbel Method...  86.0%   
[gumbel] Running Gumbel Method...  86.1%   
[gumbel] Running Gumbel Method...  86.2%   
[gumbel] Running Gumbel Method...  86.3%   
[gumbel] Running Gumbel Method...  86.4%   
[gumbel] Running Gumbel Method...  86.5%   
[gumbel] Running Gumbel Method...  86.5%   
[gumbel] Running Gumbel Method...  86.6%   
[gumbel] Running Gumbel Method...  86.7%   
[gumbel] Running Gumbel Method...  86.8%   
[gumbel] Running Gumbel Method...  86.9%   
[gumbel] Running Gumbel Method...  87.0%   
[gumbel] Running Gumbel Method...  87.1%   
[gumbel] Running Gumbel Method...  87.2%   
[gumbel] Running Gumbel Method...  87.3%   
[gumbel] Running Gumbel Method...  87.4%   
[gumbel] Running Gumbel Method...  87.5%   
[gumbel] Running Gumbel Method...  87.5%   
[gumbel] Running Gumbel Method...  87.6%   
[gumbel] Running Gumbel Method...  87.7%   
[gumbel] Running Gumbel Method...  87.8%   
[gumbel] Running Gumbel Method...  87.9%   
[gumbel] Running Gumbel Method...  88.0%   
[gumbel] Running Gumbel Method...  88.1%   
[gumbel] Running Gumbel Method...  88.2%   
[gumbel] Running Gumbel Method...  88.3%   
[gumbel] Running Gumbel Method...  88.4%   
[gumbel] Running Gumbel Method...  88.5%   
[gumbel] Running Gumbel Method...  88.5%   
[gumbel] Running Gumbel Method...  88.6%   
[gumbel] Running Gumbel Method...  88.7%   
[gumbel] Running Gumbel Method...  88.8%   
[gumbel] Running Gumbel Method...  88.9%   
[gumbel] Running Gumbel Method...  89.0%   
[gumbel] Running Gumbel Method...  89.1%   
[gumbel] Running Gumbel Method...  89.2%   
[gumbel] Running Gumbel Method...  89.3%   
[gumbel] Running Gumbel Method...  89.4%   
[gumbel] Running Gumbel Method...  89.5%   
[gumbel] Running Gumbel Method...  89.5%   
[gumbel] Running Gumbel Method...  89.6%   
[gumbel] Running Gumbel Method...  89.7%   
[gumbel] Running Gumbel Method...  89.8%   
[gumbel] Running Gumbel Method...  89.9%   
[gumbel] Running Gumbel Method...  90.0%   
[gumbel] Running Gumbel Method...  90.1%   
[gumbel] Running Gumbel Method...  90.2%   
[gumbel] Running Gumbel Method...  90.3%   
[gumbel] Running Gumbel Method...  90.4%   
[gumbel] Running Gumbel Method...  90.5%   
[gumbel] Running Gumbel Method...  90.5%   
[gumbel] Running Gumbel Method...  90.6%   
[gumbel] Running Gumbel Method...  90.7%   
[gumbel] Running Gumbel Method...  90.8%   
[gumbel] Running Gumbel Method...  90.9%   
[gumbel] Running Gumbel Method...  91.0%   
[gumbel] Running Gumbel Method...  91.1%   
[gumbel] Running Gumbel Method...  91.2%   
[gumbel] Running Gumbel Method...  91.3%   
[gumbel] Running Gumbel Method...  91.4%   
[gumbel] Running Gumbel Method...  91.5%   
[gumbel] Running Gumbel Method...  91.5%   
[gumbel] Running Gumbel Method...  91.6%   
[gumbel] Running Gumbel Method...  91.7%   
[gumbel] Running Gumbel Method...  91.8%   
[gumbel] Running Gumbel Method...  91.9%   
[gumbel] Running Gumbel Method...  92.0%   
[gumbel] Running Gumbel Method...  92.1%   
[gumbel] Running Gumbel Method...  92.2%   
[gumbel] Running Gumbel Method...  92.3%   
[gumbel] Running Gumbel Method...  92.4%   
[gumbel] Running Gumbel Method...  92.5%   
[gumbel] Running Gumbel Method...  92.5%   
[gumbel] Running Gumbel Method...  92.6%   
[gumbel] Running Gumbel Method...  92.7%   
[gumbel] Running Gumbel Method...  92.8%   
[gumbel] Running Gumbel Method...  92.9%   
[gumbel] Running Gumbel Method...  93.0%   
[gumbel] Running Gumbel Method...  93.1%   
[gumbel] Running Gumbel Method...  93.2%   
[gumbel] Running Gumbel Method...  93.3%   
[gumbel] Running Gumbel Method...  93.4%   
[gumbel] Running Gumbel Method...  93.5%   
[gumbel] Running Gumbel Method...  93.5%   
[gumbel] Running Gumbel Method...  93.6%   
[gumbel] Running Gumbel Method...  93.7%   
[gumbel] Running Gumbel Method...  93.8%   
[gumbel] Running Gumbel Method...  93.9%   
[gumbel] Running Gumbel Method...  94.0%   
[gumbel] Running Gumbel Method...  94.1%   
[gumbel] Running Gumbel Method...  94.2%   
[gumbel] Running Gumbel Method...  94.3%   
[gumbel] Running Gumbel Method...  94.4%   
[gumbel] Running Gumbel Method...  94.5%   
[gumbel] Running Gumbel Method...  94.5%   
[gumbel] Running Gumbel Method...  94.6%   
[gumbel] Running Gumbel Method...  94.7%   
[gumbel] Running Gumbel Method...  94.8%   
[gumbel] Running Gumbel Method...  94.9%   
[gumbel] Running Gumbel Method...  95.0%   
[gumbel] Running Gumbel Method...  95.1%   
[gumbel] Running Gumbel Method...  95.2%   
[gumbel] Running Gumbel Method...  95.3%   
[gumbel] Running Gumbel Method...  95.4%   
[gumbel] Running Gumbel Method...  95.5%   
[gumbel] Running Gumbel Method...  95.5%   
[gumbel] Running Gumbel Method...  95.6%   
[gumbel] Running Gumbel Method...  95.7%   
[gumbel] Running Gumbel Method...  95.8%   
[gumbel] Running Gumbel Method...  95.9%   
[gumbel] Running Gumbel Method...  96.0%   
[gumbel] Running Gumbel Method...  96.1%   
[gumbel] Running Gumbel Method...  96.2%   
[gumbel] Running Gumbel Method...  96.3%   
[gumbel] Running Gumbel Method...  96.4%   
[gumbel] Running Gumbel Method...  96.5%   
[gumbel] Running Gumbel Method...  96.5%   
[gumbel] Running Gumbel Method...  96.6%   
[gumbel] Running Gumbel Method...  96.7%   
[gumbel] Running Gumbel Method...  96.8%   
[gumbel] Running Gumbel Method...  96.9%   
[gumbel] Running Gumbel Method...  97.0%   
[gumbel] Running Gumbel Method...  97.1%   
[gumbel] Running Gumbel Method...  97.2%   
[gumbel] Running Gumbel Method...  97.3%   
[gumbel] Running Gumbel Method...  97.4%   
[gumbel] Running Gumbel Method...  97.5%   
[gumbel] Running Gumbel Method...  97.5%   
[gumbel] Running Gumbel Method...  97.6%   
[gumbel] Running Gumbel Method...  97.7%   
[gumbel] Running Gumbel Method...  97.8%   
[gumbel] Running Gumbel Method...  97.9%   
[gumbel] Running Gumbel Method...  98.0%   
[gumbel] Running Gumbel Method...  98.1%   
[gumbel] Running Gumbel Method...  98.2%   
[gumbel] Running Gumbel Method...  98.3%   
[gumbel] Running Gumbel Method...  98.4%   
[gumbel] Running Gumbel Method...  98.5%   
[gumbel] Running Gumbel Method...  98.5%   
[gumbel] Running Gumbel Method...  98.6%   
[gumbel] Running Gumbel Method...  98.7%   
[gumbel] Running Gumbel Method...  98.8%   
[gumbel] Running Gumbel Method...  98.9%   
[gumbel] Running Gumbel Method...  99.0%   
[gumbel] Running Gumbel Method...  99.1%   
[gumbel] Running Gumbel Method...  99.2%   
[gumbel] Running Gumbel Method...  99.3%   
[gumbel] Running Gumbel Method...  99.4%   
[gumbel] Running Gumbel Method...  99.5%   
[gumbel] Running Gumbel Method...  99.5%   
[gumbel] Running Gumbel Method...  99.6%   
[gumbel] Running Gumbel Method...  99.7%   
[gumbel] Running Gumbel Method...  99.8%   
[gumbel] Running Gumbel Method...  99.9%   
[gumbel] Running Gumbel Method... 100.0%   
/<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/gumbel.py:498: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead
  pval = 1 - scipy.exp(scipy.stats.gumbel_r.logcdf(r,u,B))
/<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/gumbel.py:522: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead
  h0 = ((scipy.exp(scipy.stats.gumbel_r.logpdf(R,mu,sigma))) * scipy.stats.norm.pdf(S, mu_s*R, sigma_s)  * (1-w1))
ok
test_HMM (tests.test_analysis_methods.TestMethods) ... [gumbel] 
[gumbel] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[gumbel] Finished Gumbel Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_HMM
####################
[hmm] Starting HMM Method
[hmm] Getting Data
[hmm] Normalizing using: TTR
[hmm] Running HMM Method...   2.5%   
[hmm] Running HMM Method...   5.0%   
[hmm] Running HMM Method...   7.5%   
[hmm] Running HMM Method...  10.0%   
[hmm] Running HMM Method...  12.5%   
[hmm] Running HMM Method...  15.0%   
[hmm] Running HMM Method...  17.5%   
[hmm] Running HMM Method...  20.0%   
[hmm] Running HMM Method...  22.5%   
[hmm] Running HMM Method...  25.0%   
[hmm] Running HMM Method...  27.5%   
[hmm] Running HMM Method...  30.0%   
[hmm] Running HMM Method...  32.5%   
[hmm] Running HMM Method...  35.0%   
[hmm] Running HMM Method...  37.5%   
[hmm] Running HMM Method...  40.0%   
[hmm] Running HMM Method...  42.5%   
[hmm] Running HMM Method...  45.0%   
[hmm] Running HMM Method...  47.5%   
[hmm] Running HMM Method...  50.0%   
[hmm] Running HMM Method... 50.0%   
[hmm] Running HMM Method... 52.5%   
[hmm] Running HMM Method... 55.0%   
[hmm] Running HMM Method... 57.5%   
[hmm] Running HMM Method... 60.0%   
[hmm] Running HMM Method... 62.5%   
[hmm] Running HMM Method... 65.0%   
[hmm] Running HMM Method... 67.5%   
[hmm] Running HMM Method... 70.0%   
[hmm] Running HMM Method... 72.5%   
[hmm] Running HMM Method... 75.0%   
[hmm] Running HMM Method... 77.5%   
[hmm] Running HMM Method... 80.0%   
[hmm] Running HMM Method... 82.5%   
[hmm] Running HMM Method... 85.0%   
[hmm] Running HMM Method... 87.5%   
[hmm] Running HMM Method... 90.0%   
[hmm] Running HMM Method... 92.5%   
[hmm] Running HMM Method... 95.0%   
[hmm] Running HMM Method... 97.5%   
/<<PKGBUILDDIR>>/tests/../src/pytransit/analysis/hmm.py:194: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
  T = len([1 for line in open(ctrldata[0]).readlines() if not line.startswith("#")])
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.wig' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_anova (tests.test_analysis_methods.TestMethods) ... [hmm] 
[hmm] Finished HMM - Sites Method
[hmm] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[hmm] Creating HMM Genes Level Output
[hmm] Adding File: /<<PKGBUILDDIR>>/tests/testoutput_genes.txt
[hmm] Finished HMM Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_anova
####################
[anova] Starting Anova analysis
[anova] Getting Data
[anova] Normalizing using: TTR
[anova] Running Anova
[anova] Running Anova Method...   2.0%   
[anova] Running Anova Method...   3.9%   
[anova] Running Anova Method...   5.9%   
[anova] Running Anova Method...   7.8%   
[anova] Running Anova Method...   9.8%   
[anova] Running Anova Method...  11.8%   
[anova] Running Anova Method...  13.7%   
[anova] Running Anova Method...  15.7%   
[anova] Running Anova Method...  17.6%   
[anova] Running Anova Method...  19.6%   
[anova] Running Anova Method...  21.6%   
[anova] Running Anova Method...  23.5%   
[anova] Running Anova Method...  25.5%   
[anova] Running Anova Method...  27.5%   
[anova] Running Anova Method...  29.4%   
[anova] Running Anova Method...  31.4%   
[anova] Running Anova Method...  33.3%   
[anova] Running Anova Method...  35.3%   
[anova] Running Anova Method...  37.3%   
[anova] Running Anova Method...  39.2%   
[anova] Running Anova Method...  41.2%   
[anova] Running Anova Method...  43.1%   
[anova] Running Anova Method...  45.1%   
[anova] Running Anova Method...  47.1%   
[anova] Running Anova Method...  49.0%   
[anova] Running Anova Method...  51.0%   
[anova] Running Anova Method...  52.9%   
[anova] Running Anova Method...  54.9%   
[anova] Running Anova Method...  56.9%   
[anova] Running Anova Method...  58.8%   
[anova] Running Anova Method...  60.8%   
[anova] Running Anova Method...  62.7%   
[anova] Running Anova Method...  64.7%   
[anova] Running Anova Method...  66.7%   
[anova] Running Anova Method...  68.6%   
[anova] Running Anova Method...  70.6%   
[anova] Running Anova Method...  72.5%   
[anova] Running Anova Method...  74.5%   
[anova] Running Anova Method...  76.5%   
[anova] Running Anova Method...  78.4%   
[anova] Running Anova Method...  80.4%   
[anova] Running Anova Method...  82.4%   
[anova] Running Anova Method...  84.3%   
[anova] Running Anova Method...  86.3%   
[anova] Running Anova Method...  88.2%   
[anova] Running Anova Method...  90.2%   
[anova] Running Anova Method...  92.2%   
[anova] Running Anova Method...  94.1%   
[anova] Running Anova Method...  96.1%   
[anova] Running Anova Method...  98.0%   
[anova] Running Anova Method... 100.0%   
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:121: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test.prot_table' mode='r' encoding='UTF-8'>
  for line in open(fname):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/transit_test.py:89: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='r' encoding='UTF-8'>
  for line in open(fname):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_resampling (tests.test_analysis_methods.TestMethods) ... [anova] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[anova] Finished Anova analysis
[anova] Time: 5.5s

Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_resampling
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Performing LOESS Correction
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Performing LOESS Correction
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_adaptive (tests.test_analysis_methods.TestMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_resampling_adaptive
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_combined_wig (tests.test_analysis_methods.TestMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_resampling_combined_wig
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
FAIL
test_resampling_histogram (tests.test_analysis_methods.TestMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
38
33
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_resampling_histogram
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_multistrain (tests.test_analysis_methods.TestMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing histogram files
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_resampling_multistrain
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Multiple annotation files found
[resampling] Mapping ctrl data to /<<PKGBUILDDIR>>/tests/data/test.prot_table, exp data to /<<PKGBUILDDIR>>/tests/data/test.prot_table
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_utest (tests.test_analysis_methods.TestMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing histogram files
Removing output file...


####################
tests.test_analysis_methods.TestMethods.test_utest
####################
[utest] Starting Mann-Whitney U-test Method
[utest] Getting Data
[utest] Normalizing using: TTR
[utest] Running Mann-Whitney U-test Method... 2.0%   
[utest] Running Mann-Whitney U-test Method... 3.9%   
[utest] Running Mann-Whitney U-test Method... 5.9%   
[utest] Running Mann-Whitney U-test Method... 7.8%   
[utest] Running Mann-Whitney U-test Method... 9.8%   
[utest] Running Mann-Whitney U-test Method... 11.8%   
[utest] Running Mann-Whitney U-test Method... 13.7%   
[utest] Running Mann-Whitney U-test Method... 15.7%   
[utest] Running Mann-Whitney U-test Method... 17.6%   
[utest] Running Mann-Whitney U-test Method... 19.6%   
[utest] Running Mann-Whitney U-test Method... 21.6%   
[utest] Running Mann-Whitney U-test Method... 23.5%   
[utest] Running Mann-Whitney U-test Method... 25.5%   
[utest] Running Mann-Whitney U-test Method... 27.5%   
[utest] Running Mann-Whitney U-test Method... 29.4%   
[utest] Running Mann-Whitney U-test Method... 31.4%   
[utest] Running Mann-Whitney U-test Method... 33.3%   
[utest] Running Mann-Whitney U-test Method... 35.3%   
[utest] Running Mann-Whitney U-test Method... 37.3%   
[utest] Running Mann-Whitney U-test Method... 39.2%   
[utest] Running Mann-Whitney U-test Method... 41.2%   
[utest] Running Mann-Whitney U-test Method... 43.1%   
[utest] Running Mann-Whitney U-test Method... 45.1%   
[utest] Running Mann-Whitney U-test Method... 47.1%   
[utest] Running Mann-Whitney U-test Method... 49.0%   
[utest] Running Mann-Whitney U-test Method... 51.0%   
[utest] Running Mann-Whitney U-test Method... 52.9%   
[utest] Running Mann-Whitney U-test Method... 54.9%   
[utest] Running Mann-Whitney U-test Method... 56.9%   
[utest] Running Mann-Whitney U-test Method... 58.8%   
[utest] Running Mann-Whitney U-test Method... 60.8%   
[utest] Running Mann-Whitney U-test Method... 62.7%   
[utest] Running Mann-Whitney U-test Method... 64.7%   
[utest] Running Mann-Whitney U-test Method... 66.7%   
[utest] Running Mann-Whitney U-test Method... 68.6%   
[utest] Running Mann-Whitney U-test Method... 70.6%   
[utest] Running Mann-Whitney U-test Method... 72.5%   
[utest] Running Mann-Whitney U-test Method... 74.5%   
[utest] Running Mann-Whitney U-test Method... 76.5%   
[utest] Running Mann-Whitney U-test Method... 78.4%   
[utest] Running Mann-Whitney U-test Method... 80.4%   
[utest] Running Mann-Whitney U-test Method... 82.4%   
[utest] Running Mann-Whitney U-test Method... 84.3%   
[utest] Running Mann-Whitney U-test Method... 86.3%   
[utest] Running Mann-Whitney U-test Method... 88.2%   
[utest] Running Mann-Whitney U-test Method... 90.2%   
[utest] Running Mann-Whitney U-test Method... 92.2%   
[utest] Running Mann-Whitney U-test Method... 94.1%   
[utest] Running Mann-Whitney U-test Method... 96.1%   
[utest] Running Mann-Whitney U-test Method... 98.0%   
[utest] Running Mann-Whitney U-test Method... 100.0%   
ok
test_zinb (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_zinb_covariates (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_zinb_interactions (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2'
test_TTR (tests.test_norm_methods.TestNormMethods) ... ok
test_nonorm (tests.test_norm_methods.TestNormMethods) ... ok
test_resampling_NZMean (tests.test_norm_methods.TestNormMethods) ... [utest] 
[utest] Performing Benjamini-Hochberg Correction
[utest] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[utest] Finished Mann-Whitney U-test Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_TTR
####################


####################
tests.test_norm_methods.TestNormMethods.test_nonorm
####################


####################
tests.test_norm_methods.TestNormMethods.test_resampling_NZMean
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: nzmean
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: nzmean
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_Quantile (tests.test_norm_methods.TestNormMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_resampling_Quantile
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: quantile
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: quantile
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
/<<PKGBUILDDIR>>/tests/transit_test.py:75: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/testoutput.txt' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_resampling_TTR (tests.test_norm_methods.TestNormMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_resampling_TTR
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: TTR
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: TTR
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_TotReads (tests.test_norm_methods.TestNormMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_resampling_TotReads
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: totreads
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: totreads
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_ZINFNB (tests.test_norm_methods.TestNormMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_resampling_ZINFNB
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Normalizing using: zinfnb
[resampling] Preprocessing Exp data...
[resampling] Normalizing using: zinfnb
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_resampling_nonorm (tests.test_norm_methods.TestNormMethods) ... [resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_norm_methods.TestNormMethods.test_resampling_nonorm
####################
[resampling] Starting resampling Method
[resampling] Getting Data
[resampling] Preprocessing Ctrl data...
[resampling] Preprocessing Exp data...
[resampling] Running Resampling Method...   2.0%   
[resampling] Running Resampling Method...   3.9%   
[resampling] Running Resampling Method...   5.9%   
[resampling] Running Resampling Method...   7.8%   
[resampling] Running Resampling Method...   9.8%   
[resampling] Running Resampling Method...  11.8%   
[resampling] Running Resampling Method...  13.7%   
[resampling] Running Resampling Method...  15.7%   
[resampling] Running Resampling Method...  17.6%   
[resampling] Running Resampling Method...  19.6%   
[resampling] Running Resampling Method...  21.6%   
[resampling] Running Resampling Method...  23.5%   
[resampling] Running Resampling Method...  25.5%   
[resampling] Running Resampling Method...  27.5%   
[resampling] Running Resampling Method...  29.4%   
[resampling] Running Resampling Method...  31.4%   
[resampling] Running Resampling Method...  33.3%   
[resampling] Running Resampling Method...  35.3%   
[resampling] Running Resampling Method...  37.3%   
[resampling] Running Resampling Method...  39.2%   
[resampling] Running Resampling Method...  41.2%   
[resampling] Running Resampling Method...  43.1%   
[resampling] Running Resampling Method...  45.1%   
[resampling] Running Resampling Method...  47.1%   
[resampling] Running Resampling Method...  49.0%   
[resampling] Running Resampling Method...  51.0%   
[resampling] Running Resampling Method...  52.9%   
[resampling] Running Resampling Method...  54.9%   
[resampling] Running Resampling Method...  56.9%   
[resampling] Running Resampling Method...  58.8%   
[resampling] Running Resampling Method...  60.8%   
[resampling] Running Resampling Method...  62.7%   
[resampling] Running Resampling Method...  64.7%   
[resampling] Running Resampling Method...  66.7%   
[resampling] Running Resampling Method...  68.6%   
[resampling] Running Resampling Method...  70.6%   
[resampling] Running Resampling Method...  72.5%   
[resampling] Running Resampling Method...  74.5%   
[resampling] Running Resampling Method...  76.5%   
[resampling] Running Resampling Method...  78.4%   
[resampling] Running Resampling Method...  80.4%   
[resampling] Running Resampling Method...  82.4%   
[resampling] Running Resampling Method...  84.3%   
[resampling] Running Resampling Method...  86.3%   
[resampling] Running Resampling Method...  88.2%   
[resampling] Running Resampling Method...  90.2%   
[resampling] Running Resampling Method...  92.2%   
[resampling] Running Resampling Method...  94.1%   
[resampling] Running Resampling Method...  96.1%   
[resampling] Running Resampling Method...  98.0%   
[resampling] Running Resampling Method... 100.0%   
ok
test_cleanargs_flag_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_flag_arguments_with_double_dash (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_flag_without_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_negative_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_positional_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_cleanargs_positional_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_file_types (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_genes_creation_fromdata (tests.test_pytransit_tools.TestTnSeqTools) ... /<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
  for line in open(path):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'>
  for line in open(self.annotation):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
ok
test_genes_creation_fromwig (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_normalization (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_read_data (tests.test_pytransit_tools.TestTnSeqTools) ... ok
test_tpp_flag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file'
test_tpp_multicontig_auto_replicon_ids (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq and 
[tn_preprocess] protocol: Sassetti
[tn_preprocess] transposon type: Himar1
[tn_preprocess] One reference genome specified: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna, containing 3 records.
[tn_preprocess] Autogenerating replicon_ids...
[tn_preprocess] extracting reads...
[tn_preprocess] fastq2reads: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq -> /<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:85: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq' mode='r' encoding='UTF-8'>
  for line in open(infile):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] assuming single-ended reads
[tn_preprocess] creating /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1
[tn_preprocess] prefix sequence: 
[tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20]
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:276: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
  for line in open(infile):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] mapping reads using BWA...(this takes a couple of minutes)
[tn_preprocess] /usr/bin/bwa index /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
b'[bwa_index] Pack FASTA... 0.47 sec'
b'[bwa_index] Construct BWT for the packed sequence...'
b'[bwa_index] 15.05 seconds elapse.'
b'[bwa_index] Update BWT... 0.59 sec'
b'[bwa_index] Pack forward-only FASTA... 0.31 sec'
b'[bwa_index] Construct SA from BWT and Occ... 12.58 sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa index /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna'
b'[main] Real time: 30.155 sec; CPU: 29.015 sec'
b''
[tn_preprocess] /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1 > /<<PKGBUILDDIR>>/tests/test_tpp_temp.sam
b'[M::bwa_idx_load_from_disk] read 0 ALT contigs'
b'[M::process] read 2500 sequences (304052 bp)...'
b'[M::mem_process_seqs] Processed 2500 reads in 1.920 CPU sec, 1.922 real sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1'
b'[main] Real time: 2.359 sec; CPU: 2.015 sec'
b''
[tn_preprocess] tabulating template counts and statistics for reference genome /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:378: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/data/test-multicontig.fna' mode='r' encoding='UTF-8'>
  for line in open(filename):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:560: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.sam' mode='r' encoding='UTF-8'>
  for line in open(sam):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_1.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_2.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_3.wig
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1108: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
  for line in open(vars.reads1):
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1117: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'>
  read_length = get_read_length(vars.base + ".reads1")
ResourceWarning: Enable tracemalloc to get the object allocation traceback
/<<PKGBUILDDIR>>/tests/../src/pytpp/tpp_tools.py:1118: ResourceWarning: unclosed file <_io.TextIOWrapper name='/<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1' mode='r' encoding='UTF-8'>
  mean_r1_genomic = get_genomic_portion(vars.base + ".trimmed1")
ResourceWarning: Enable tracemalloc to get the object allocation traceback
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp.tn_stats
[tn_preprocess] Done.
ok
test_tpp_multicontig_empty_prefix (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq and 
[tn_preprocess] protocol: Sassetti
[tn_preprocess] transposon type: Himar1
[tn_preprocess] One reference genome specified: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna, containing 3 records.
[tn_preprocess] extracting reads...
[tn_preprocess] fastq2reads: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq -> /<<PKGBUILDDIR>>/tests/test_tpp_temp.reads1
[tn_preprocess] assuming single-ended reads
[tn_preprocess] creating /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1
[tn_preprocess] prefix sequence: 
[tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20]
[tn_preprocess] mapping reads using BWA...(this takes a couple of minutes)
[tn_preprocess] /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1 > /<<PKGBUILDDIR>>/tests/test_tpp_temp.sam
b'[M::bwa_idx_load_from_disk] read 0 ALT contigs'
b'[M::process] read 2500 sequences (304052 bp)...'
b'[M::mem_process_seqs] Processed 2500 reads in 1.925 CPU sec, 1.923 real sec'
b'[main] Version: 0.7.17-r1188'
b'[main] CMD: /usr/bin/bwa mem /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna /<<PKGBUILDDIR>>/tests/test_tpp_temp.trimmed1'
b'[main] Real time: 2.359 sec; CPU: 2.015 sec'
b''
[tn_preprocess] tabulating template counts and statistics for reference genome /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_a.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_b.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp_c.wig
[tn_preprocess] writing /<<PKGBUILDDIR>>/tests/test_tpp_temp.tn_stats
[tn_preprocess] Done.
ok
test_tpp_noflag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file'
test_tpp_protocol_mme1 (tests.test_tpp.TestTPP) ... skipped 'requires local data file'

======================================================================
FAIL: test_resampling_combined_wig (tests.test_analysis_methods.TestMethods)
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/<<PKGBUILDDIR>>/tests/test_analysis_methods.py", line 98, in test_resampling_combined_wig
    self.assertLessEqual(
AssertionError: 2 not less than or equal to 1 : sig_qvals expected in range: [34, 36], actual: 33

----------------------------------------------------------------------
Ran 39 tests in 1698.925s

FAILED (failures=1, skipped=6)
[resampling] 
[resampling] Performing Benjamini-Hochberg Correction
[resampling] Adding File: /<<PKGBUILDDIR>>/tests/testoutput.txt
[resampling] Finished resampling Method
Removing output file...


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_w_quotes
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_with_double_dash
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_without_arguments
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_negative_arguments
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments_w_quotes
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_file_types
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromdata
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromwig
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_normalization
####################


####################
tests.test_pytransit_tools.TestTnSeqTools.test_read_data
####################


####################
tests.test_tpp.TestTPP.test_tpp_multicontig_auto_replicon_ids
####################
# title: Tn-Seq Pre-Processor
# date: 08/28/2020 04:43:30
# command: python python3.8 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py
# transposon type: Himar1
# protocol type: Sassetti
# bwa flags:
# read1: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq
# read2:
# ref_genome: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
# replicon_ids: 1,2,3
# total_reads (or read pairs): 2500
# trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512
# reads1_mapped: 2116
# reads2_mapped: 0
# mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116
# read_count (TA sites only, for Himar1):
#   1: 63
#   2: 0
#   3: 0
# template_count:
#   1: 63
#   2: 0
#   3: 0
# template_ratio (reads per template):
#   1: 1.00
#   2: 0.00
#   3: 0.00
# TA_sites:
#   1: 89994
#   2: 646
#   3: 664
# TAs_hit:
#   1: 63
#   2: 0
#   3: 0
# density:
#   1: 0.001
#   2: 0.000
#   3: 0.000
# max_count (among templates):
#   1: 1
#   2: 0
#   3: 0
# max_site (coordinate):
#   1: 4977050
#   2: 57441
#   3: 38111
# NZ_mean (among templates):
#   1: 1.0
#   2: 0.0
#   3: 0.0
# FR_corr (Fwd templates vs. Rev templates):
#   1: -0.000
#   2: nan
#   3: nan
# BC_corr (reads vs. templates, summed over both strands):
#   1: nan
#   2: nan
#   3: nan
# primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1)
# vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7)
# adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index)
# misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA
# read_length: 125 bp
# mean_R1_genomic_length: 121.6 bp
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file


####################
tests.test_tpp.TestTPP.test_tpp_multicontig_empty_prefix
####################
# title: Tn-Seq Pre-Processor
# date: 08/28/2020 04:43:53
# command: python python3.8 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py
# transposon type: Himar1
# protocol type: Sassetti
# bwa flags:
# read1: /<<PKGBUILDDIR>>/tests/data/test-multicontig-1.fastq
# read2:
# ref_genome: /<<PKGBUILDDIR>>/tests/data/test-multicontig.fna
# replicon_ids: a,b,c
# total_reads (or read pairs): 2500
# trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512
# reads1_mapped: 2116
# reads2_mapped: 0
# mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116
# read_count (TA sites only, for Himar1):
#   a: 63
#   b: 0
#   c: 0
# template_count:
#   a: 63
#   b: 0
#   c: 0
# template_ratio (reads per template):
#   a: 1.00
#   b: 0.00
#   c: 0.00
# TA_sites:
#   a: 89994
#   b: 646
#   c: 664
# TAs_hit:
#   a: 63
#   b: 0
#   c: 0
# density:
#   a: 0.001
#   b: 0.000
#   c: 0.000
# max_count (among templates):
#   a: 1
#   b: 0
#   c: 0
# max_site (coordinate):
#   a: 4977050
#   b: 57441
#   c: 38111
# NZ_mean (among templates):
#   a: 1.0
#   b: 0.0
#   c: 0.0
# FR_corr (Fwd templates vs. Rev templates):
#   a: -0.000
#   b: nan
#   c: nan
# BC_corr (reads vs. templates, summed over both strands):
#   a: nan
#   b: nan
#   c: nan
# primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1)
# vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7)
# adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index)
# misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA
# read_length: 125 bp
# mean_R1_genomic_length: 121.6 bp
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
Removing tpp test file
E: pybuild pybuild:352: test: plugin custom failed with: exit code=1: PYTHONPATH=tests python3.8 -m unittest -v tests/*.py
dh_auto_test: error: pybuild --test -i python{version} -p 3.8 --system=custom "--test-args=PYTHONPATH=tests {interpreter} -m unittest -v tests/*.py" returned exit code 13
make[1]: *** [debian/rules:23: override_dh_auto_test] Error 25
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
make: *** [debian/rules:9: binary-arch] Error 2
dpkg-buildpackage: error: debian/rules binary-arch subprocess returned exit status 2
--------------------------------------------------------------------------------
Build finished at 2020-08-28T04:43:55Z

Finished
--------


+------------------------------------------------------------------------------+
| Cleanup                                                                      |
+------------------------------------------------------------------------------+

Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
E: Build failure (dpkg-buildpackage died)

+------------------------------------------------------------------------------+
| Summary                                                                      |
+------------------------------------------------------------------------------+

Build Architecture: armhf
Build-Space: 0
Build-Time: 1748
Distribution: bullseye-staging
Fail-Stage: build
Host Architecture: armhf
Install-Time: 725
Job: tnseq-transit_3.1.0-2
Machine Architecture: armhf
Package: tnseq-transit
Package-Time: 2526
Source-Version: 3.1.0-2
Space: 0
Status: failed
Version: 3.1.0-2
--------------------------------------------------------------------------------
Finished at 2020-08-28T04:43:55Z
Build needed 00:00:00, 0k disc space
Raspbian Package Auto-Building

Build log for tnseq-transit (3.1.0-2) on armhf
